Incidental Mutation 'R7693:Noc2l'
ID593487
Institutional Source Beutler Lab
Gene Symbol Noc2l
Ensembl Gene ENSMUSG00000095567
Gene NameNOC2 like nucleolar associated transcriptional repressor
SynonymsNIR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location156236010-156247616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156240307 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 280 (H280Q)
Ref Sequence ENSEMBL: ENSMUSP00000137253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179543] [ENSMUST00000179886]
Predicted Effect probably damaging
Transcript: ENSMUST00000179543
AA Change: H280Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137253
Gene: ENSMUSG00000095567
AA Change: H280Q

DomainStartEndE-ValueType
low complexity region 21 58 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 121 139 N/A INTRINSIC
Pfam:Noc2 331 626 1.8e-128 PFAM
low complexity region 651 675 N/A INTRINSIC
low complexity region 701 723 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179886
AA Change: H123Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137183
Gene: ENSMUSG00000095567
AA Change: H123Q

DomainStartEndE-ValueType
Pfam:Noc2 172 470 1.2e-117 PFAM
low complexity region 494 518 N/A INTRINSIC
low complexity region 544 566 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histone modification by histone acetyltransferases (HAT) and histone deacetylases (HDAC) can control major aspects of transcriptional regulation. NOC2L represents a novel HDAC-independent inhibitor of histone acetyltransferase (INHAT) (Hublitz et al., 2005 [PubMed 16322561]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice lacking expression of this gene display embryonic lethality prior to the tooth bud stage. Mice with an immune cell deletion display impaired T and B cell differentiation with a cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Noc2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Noc2l UTSW 4 156240096 small insertion probably benign
FR4449:Noc2l UTSW 4 156240101 small insertion probably benign
FR4548:Noc2l UTSW 4 156240092 small insertion probably benign
FR4548:Noc2l UTSW 4 156240100 small insertion probably benign
FR4737:Noc2l UTSW 4 156240094 small insertion probably benign
FR4737:Noc2l UTSW 4 156240095 small insertion probably benign
FR4737:Noc2l UTSW 4 156241501 critical splice donor site probably benign
FR4976:Noc2l UTSW 4 156240092 small insertion probably benign
FR4976:Noc2l UTSW 4 156240098 small insertion probably benign
R1577:Noc2l UTSW 4 156240622 missense probably damaging 1.00
R1633:Noc2l UTSW 4 156245293 missense probably benign 0.20
R1858:Noc2l UTSW 4 156245270 missense probably damaging 1.00
R1862:Noc2l UTSW 4 156237708 missense probably benign 0.00
R2069:Noc2l UTSW 4 156241450 nonsense probably null
R2862:Noc2l UTSW 4 156237450 missense probably benign 0.30
R4092:Noc2l UTSW 4 156242576 missense probably damaging 1.00
R4369:Noc2l UTSW 4 156237396 missense possibly damaging 0.68
R4964:Noc2l UTSW 4 156245911 missense probably damaging 0.98
R4966:Noc2l UTSW 4 156245911 missense probably damaging 0.98
R5922:Noc2l UTSW 4 156241313 nonsense probably null
R7081:Noc2l UTSW 4 156247020 missense possibly damaging 0.80
R7171:Noc2l UTSW 4 156241722 missense probably benign 0.05
R7315:Noc2l UTSW 4 156241360 missense probably damaging 0.98
R7317:Noc2l UTSW 4 156239216 missense possibly damaging 0.93
R7581:Noc2l UTSW 4 156245449 missense probably benign 0.00
R7690:Noc2l UTSW 4 156237631 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCCGTGTGGATGTCAAGAC -3'
(R):5'- CCTAGTCTCACATTACTAAGCCACG -3'

Sequencing Primer
(F):5'- TGTCAAGACATACCTAAGTGCG -3'
(R):5'- TAAGCCACGCTGTCCTGAAAGG -3'
Posted On2019-11-12