Incidental Mutation 'R7693:Zfp316'
ID593489
Institutional Source Beutler Lab
Gene Symbol Zfp316
Ensembl Gene ENSMUSG00000046658
Gene Namezinc finger protein 316
SynonymsEmzf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location143249697-143270022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143263412 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 156 (T156I)
Ref Sequence ENSEMBL: ENSMUSP00000059418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051665] [ENSMUST00000161448]
Predicted Effect unknown
Transcript: ENSMUST00000051665
AA Change: T156I
SMART Domains Protein: ENSMUSP00000059418
Gene: ENSMUSG00000046658
AA Change: T156I

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161448
AA Change: T156I
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658
AA Change: T156I

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Other mutations in Zfp316
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Zfp316 APN 5 143254426 missense probably benign 0.00
IGL01783:Zfp316 APN 5 143262876 missense unknown
R0415:Zfp316 UTSW 5 143264491 missense unknown
R0423:Zfp316 UTSW 5 143253238 missense probably damaging 0.98
R1576:Zfp316 UTSW 5 143264094 missense unknown
R1579:Zfp316 UTSW 5 143253562 missense probably damaging 0.97
R1836:Zfp316 UTSW 5 143253423 missense probably damaging 1.00
R2058:Zfp316 UTSW 5 143263406 missense unknown
R4004:Zfp316 UTSW 5 143255119 missense possibly damaging 0.86
R4198:Zfp316 UTSW 5 143254471 missense probably benign 0.05
R4436:Zfp316 UTSW 5 143254048 missense probably damaging 1.00
R4961:Zfp316 UTSW 5 143253414 missense probably damaging 0.98
R5579:Zfp316 UTSW 5 143264491 missense unknown
R5642:Zfp316 UTSW 5 143264091 missense unknown
R5701:Zfp316 UTSW 5 143254377 missense probably benign 0.08
R5795:Zfp316 UTSW 5 143262839 missense unknown
R5861:Zfp316 UTSW 5 143263340 missense unknown
R5965:Zfp316 UTSW 5 143264672 splice site probably null
R6414:Zfp316 UTSW 5 143254884 missense possibly damaging 0.71
R6547:Zfp316 UTSW 5 143254197 missense probably damaging 1.00
R6922:Zfp316 UTSW 5 143253525 missense probably damaging 0.98
R7002:Zfp316 UTSW 5 143263355 missense unknown
R7361:Zfp316 UTSW 5 143254675 missense probably benign 0.01
R7414:Zfp316 UTSW 5 143264652 missense unknown
X0022:Zfp316 UTSW 5 143255056 missense probably damaging 0.99
Z1177:Zfp316 UTSW 5 143253558 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCACCCAGAGGCCAAAATG -3'
(R):5'- GCATCTGAGGTCTTCATCTCTGG -3'

Sequencing Primer
(F):5'- AAAATGGGCTGACTTCCCC -3'
(R):5'- CTTCATCTCTGGATAGGAGAGGTC -3'
Posted On2019-11-12