Incidental Mutation 'R7693:Tmcc1'
ID593491
Institutional Source Beutler Lab
Gene Symbol Tmcc1
Ensembl Gene ENSMUSG00000030126
Gene Nametransmembrane and coiled coil domains 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116018611-116193486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116024882 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 559 (I559V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088896] [ENSMUST00000172510] [ENSMUST00000173110] [ENSMUST00000173140] [ENSMUST00000173548] [ENSMUST00000204353]
Predicted Effect
SMART Domains Protein: ENSMUSP00000032222
Gene: ENSMUSG00000030126
AA Change: I559V

DomainStartEndE-ValueType
low complexity region 153 164 N/A INTRINSIC
Pfam:Tmemb_cc2 268 677 9.7e-170 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088896
AA Change: I519V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086285
Gene: ENSMUSG00000030126
AA Change: I519V

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Pfam:Tmemb_cc2 227 636 2.3e-170 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172510
AA Change: I199V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133665
Gene: ENSMUSG00000030126
AA Change: I199V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 188 6.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173110
SMART Domains Protein: ENSMUSP00000133794
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173140
AA Change: I199V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134455
Gene: ENSMUSG00000030126
AA Change: I199V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 79 6.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173548
AA Change: I340V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145456
Gene: ENSMUSG00000030126
AA Change: I340V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 48 457 1.5e-167 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204353
AA Change: I344V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144971
Gene: ENSMUSG00000030126
AA Change: I344V

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 52 461 8.3e-171 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Tmcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Tmcc1 APN 6 116043027 missense probably damaging 0.99
IGL01580:Tmcc1 APN 6 116042985 missense possibly damaging 0.91
IGL02858:Tmcc1 APN 6 116133888 missense probably damaging 0.99
IGL03226:Tmcc1 APN 6 116133976 missense probably damaging 0.99
Dominus_dei UTSW 6 116134237 nonsense probably null
FR4976:Tmcc1 UTSW 6 116193380 start gained probably benign
IGL02988:Tmcc1 UTSW 6 116042928 missense probably damaging 1.00
PIT4581001:Tmcc1 UTSW 6 116043456 missense
R0522:Tmcc1 UTSW 6 116042870 frame shift probably null
R0654:Tmcc1 UTSW 6 116042990 missense probably benign 0.03
R0721:Tmcc1 UTSW 6 116042870 frame shift probably null
R1392:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R1573:Tmcc1 UTSW 6 116133963 missense probably damaging 0.99
R1644:Tmcc1 UTSW 6 116133865 missense probably damaging 1.00
R2062:Tmcc1 UTSW 6 116043058 missense probably benign 0.01
R2065:Tmcc1 UTSW 6 116042870 frame shift probably null
R2214:Tmcc1 UTSW 6 116042870 frame shift probably null
R2240:Tmcc1 UTSW 6 116042870 frame shift probably null
R2399:Tmcc1 UTSW 6 116042870 frame shift probably null
R3683:Tmcc1 UTSW 6 116042870 frame shift probably null
R3722:Tmcc1 UTSW 6 116133822 missense possibly damaging 0.83
R3926:Tmcc1 UTSW 6 116042913 missense probably damaging 1.00
R4082:Tmcc1 UTSW 6 116043480 missense probably damaging 1.00
R4155:Tmcc1 UTSW 6 116133804 missense probably benign 0.18
R4619:Tmcc1 UTSW 6 116043286 missense probably damaging 1.00
R5246:Tmcc1 UTSW 6 116043420 missense probably damaging 1.00
R5568:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R6364:Tmcc1 UTSW 6 116043761 start gained probably benign
R7238:Tmcc1 UTSW 6 116134237 nonsense probably null
R7257:Tmcc1 UTSW 6 116107338 missense probably benign 0.27
R7603:Tmcc1 UTSW 6 116043131 nonsense probably null
R7694:Tmcc1 UTSW 6 116133844 missense
R7698:Tmcc1 UTSW 6 116043802 nonsense probably null
R7798:Tmcc1 UTSW 6 116043578 missense
R8158:Tmcc1 UTSW 6 116043474 missense
Predicted Primers PCR Primer
(F):5'- CTTTACTGGGTCAAGGCAGGTG -3'
(R):5'- AAAGCTACAACTGCTGGCAC -3'

Sequencing Primer
(F):5'- TCAAGGCAGGTGTGTTCCAAC -3'
(R):5'- ACAGTAGTCTGGGCTTGCTCAAG -3'
Posted On2019-11-12