Incidental Mutation 'R7693:Arhgap33'
ID593493
Institutional Source Beutler Lab
Gene Symbol Arhgap33
Ensembl Gene ENSMUSG00000036882
Gene NameRho GTPase activating protein 33
SynonymsSnx26, NOMA-GAP, Tcgap
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30522226-30535060 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 30526112 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208522] [ENSMUST00000208538]
Predicted Effect probably null
Transcript: ENSMUST00000044338
SMART Domains Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
SH3 213 271 5.32e-12 SMART
low complexity region 318 335 N/A INTRINSIC
RhoGAP 350 531 4.05e-67 SMART
low complexity region 582 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 694 733 N/A INTRINSIC
low complexity region 770 798 N/A INTRINSIC
low complexity region 832 850 N/A INTRINSIC
low complexity region 894 940 N/A INTRINSIC
low complexity region 979 988 N/A INTRINSIC
low complexity region 1076 1086 N/A INTRINSIC
low complexity region 1158 1166 N/A INTRINSIC
low complexity region 1194 1216 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207858
Predicted Effect probably null
Transcript: ENSMUST00000207860
Predicted Effect probably benign
Transcript: ENSMUST00000208522
Predicted Effect probably null
Transcript: ENSMUST00000208538
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Arhgap33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Arhgap33 APN 7 30529946 missense probably damaging 0.99
IGL02176:Arhgap33 APN 7 30524051 missense possibly damaging 0.76
IGL02430:Arhgap33 APN 7 30522760 missense probably benign 0.07
IGL03091:Arhgap33 APN 7 30528293 missense probably damaging 1.00
R0276:Arhgap33 UTSW 7 30523244 missense probably benign 0.01
R0494:Arhgap33 UTSW 7 30524496 missense probably damaging 0.98
R0597:Arhgap33 UTSW 7 30526446 missense probably damaging 1.00
R0717:Arhgap33 UTSW 7 30528349 missense probably damaging 1.00
R1661:Arhgap33 UTSW 7 30532323 missense probably damaging 1.00
R1761:Arhgap33 UTSW 7 30533063 splice site probably null
R1882:Arhgap33 UTSW 7 30522809 missense probably damaging 1.00
R2161:Arhgap33 UTSW 7 30528650 splice site probably null
R2566:Arhgap33 UTSW 7 30527229 missense probably damaging 1.00
R4353:Arhgap33 UTSW 7 30524136 missense possibly damaging 0.95
R4552:Arhgap33 UTSW 7 30519108 unclassified probably benign
R4778:Arhgap33 UTSW 7 30532093 missense probably benign
R4887:Arhgap33 UTSW 7 30532192 missense probably damaging 0.99
R4957:Arhgap33 UTSW 7 30532361 missense probably damaging 0.96
R5001:Arhgap33 UTSW 7 30533016 missense possibly damaging 0.95
R5140:Arhgap33 UTSW 7 30528301 missense probably damaging 1.00
R5585:Arhgap33 UTSW 7 30523835 missense probably benign 0.00
R5704:Arhgap33 UTSW 7 30519620 unclassified probably benign
R5805:Arhgap33 UTSW 7 30526414 missense probably benign 0.01
R6476:Arhgap33 UTSW 7 30524412 missense probably damaging 0.99
R6485:Arhgap33 UTSW 7 30524004 missense probably benign
R6572:Arhgap33 UTSW 7 30527210 missense probably damaging 1.00
R7183:Arhgap33 UTSW 7 30525871 splice site probably null
R7205:Arhgap33 UTSW 7 30533009 missense probably damaging 0.99
R7241:Arhgap33 UTSW 7 30528721 missense probably damaging 1.00
R7259:Arhgap33 UTSW 7 30532200 missense probably damaging 1.00
R7319:Arhgap33 UTSW 7 30526369 missense probably benign
R7384:Arhgap33 UTSW 7 30527271 missense probably damaging 1.00
R7412:Arhgap33 UTSW 7 30523052 missense probably benign 0.00
R7747:Arhgap33 UTSW 7 30524135 missense probably damaging 0.98
R7893:Arhgap33 UTSW 7 30528776 missense probably benign 0.34
R7915:Arhgap33 UTSW 7 30523223 missense probably benign 0.08
X0034:Arhgap33 UTSW 7 30524449 small deletion probably benign
Z1176:Arhgap33 UTSW 7 30522717 missense probably benign 0.13
Z1177:Arhgap33 UTSW 7 30522817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAGATGAAGCCAGGGCC -3'
(R):5'- TGGTTCTTCGGACTGCCTAC -3'

Sequencing Primer
(F):5'- TCCTAGCTCAGTTTAGGTACATG -3'
(R):5'- GGACTGCCTACTCTTCCTGTCAC -3'
Posted On2019-11-12