Incidental Mutation 'R7693:Fxyd3'
ID593494
Institutional Source Beutler Lab
Gene Symbol Fxyd3
Ensembl Gene ENSMUSG00000057092
Gene NameFXYD domain-containing ion transport regulator 3
SynonymsMat8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location31068172-31076704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31071173 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 66 (R66S)
Ref Sequence ENSEMBL: ENSMUSP00000130245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039775] [ENSMUST00000072331] [ENSMUST00000167369] [ENSMUST00000171359]
Predicted Effect probably benign
Transcript: ENSMUST00000039775
SMART Domains Protein: ENSMUSP00000041579
Gene: ENSMUSG00000036560

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
LRR 75 98 7.17e1 SMART
LRR 99 122 2.76e1 SMART
LRR_TYP 123 146 2.43e-4 SMART
LRRCT 158 207 3.97e-5 SMART
Pfam:EPTP 214 251 1.1e-7 PFAM
Pfam:EPTP 396 438 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072331
AA Change: R10S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000072331
AA Change: R10S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000167369
AA Change: R66S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130245
Gene: ENSMUSG00000057092
AA Change: R66S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 25 71 5.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171359
AA Change: R66S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128610
Gene: ENSMUSG00000057092
AA Change: R66S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 23 72 4.9e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The encoded protein is a transmembrane protein that functions as a specific regulator of Na,K-ATPase. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Fxyd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Fxyd3 APN 7 31070893 splice site probably benign
PIT4431001:Fxyd3 UTSW 7 31071355 missense probably damaging 1.00
R0267:Fxyd3 UTSW 7 31070734 unclassified probably benign
R1120:Fxyd3 UTSW 7 31071378 splice site probably benign
R1429:Fxyd3 UTSW 7 31073621 start codon destroyed probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGCCCAGACAGTTTCTTGGC -3'
(R):5'- AGATTGGTACAGCCTCCGAGTC -3'

Sequencing Primer
(F):5'- TTTCCCACTGTATGTCTATGTAAAGC -3'
(R):5'- AGTCGGCGGGCTCATTTG -3'
Posted On2019-11-12