Incidental Mutation 'R7693:Map6'
ID 593496
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 045708-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R7693 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98985499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 671 (L671F)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000068973
AA Change: L671F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: L671F

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000207883
AA Change: L671F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect possibly damaging
Transcript: ENSMUST00000208924
AA Change: L468F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,827,968 (GRCm39) S63I probably damaging Het
Adcy10 A G 1: 165,398,340 (GRCm39) E1479G probably benign Het
Alpl C T 4: 137,471,120 (GRCm39) G339R probably damaging Het
Anapc1 A G 2: 128,483,457 (GRCm39) S1213P possibly damaging Het
Aoc3 C A 11: 101,223,338 (GRCm39) H525N probably benign Het
Arhgap33 A T 7: 30,225,537 (GRCm39) probably null Het
Arhgef4 A G 1: 34,763,222 (GRCm39) E826G probably benign Het
Art2a A T 7: 101,204,056 (GRCm39) *161R probably null Het
Azi2 A T 9: 117,876,661 (GRCm39) N59I probably damaging Het
Cdhr5 T C 7: 140,851,691 (GRCm39) T538A probably benign Het
Cilk1 A G 9: 78,065,008 (GRCm39) D306G probably benign Het
Csnk2b C A 17: 35,336,972 (GRCm39) G123C probably null Het
Dnaaf10 T C 11: 17,162,064 (GRCm39) V34A probably benign Het
Dnaja2 G T 8: 86,266,939 (GRCm39) P306Q probably damaging Het
Dusp19 A G 2: 80,447,905 (GRCm39) T60A probably benign Het
Epm2aip1 G A 9: 111,101,443 (GRCm39) G139S probably benign Het
Fer1l4 A G 2: 155,862,351 (GRCm39) F1774S possibly damaging Het
Fxyd3 T A 7: 30,770,598 (GRCm39) R66S probably benign Het
Gjd2 T C 2: 113,842,309 (GRCm39) N56S probably damaging Het
Gmcl1 A G 6: 86,691,239 (GRCm39) I252T probably benign Het
Gnl1 T C 17: 36,299,112 (GRCm39) C517R probably damaging Het
Grin1 T A 2: 25,208,679 (GRCm39) M74L possibly damaging Het
Hinfp A G 9: 44,209,642 (GRCm39) M244T probably damaging Het
Iqca1l T C 5: 24,751,626 (GRCm39) I541V probably benign Het
Kcnma1 T A 14: 23,417,680 (GRCm39) I850F probably damaging Het
Kif13a G T 13: 46,904,089 (GRCm39) T1748N probably benign Het
Lama1 C T 17: 68,124,026 (GRCm39) A2817V Het
Neb C T 2: 52,189,581 (GRCm39) A770T probably damaging Het
Noc2l T A 4: 156,324,764 (GRCm39) H280Q probably damaging Het
Ntrk1 T C 3: 87,695,733 (GRCm39) D205G probably benign Het
Or5m5 A T 2: 85,814,979 (GRCm39) Y265F probably damaging Het
Or7a37 A T 10: 78,806,137 (GRCm39) Y218F probably damaging Het
Parp9 A G 16: 35,777,282 (GRCm39) S409G possibly damaging Het
Pcnx2 G A 8: 126,613,864 (GRCm39) T529I probably benign Het
Popdc3 A G 10: 45,191,227 (GRCm39) S113G probably benign Het
Rbm8a T C 3: 96,537,624 (GRCm39) I25T probably damaging Het
Rfc4 A G 16: 22,946,163 (GRCm39) W40R probably damaging Het
Rp1 T C 1: 4,417,626 (GRCm39) D1162G probably damaging Het
Slc14a2 G A 18: 78,197,218 (GRCm39) A846V possibly damaging Het
Spx A G 6: 142,360,516 (GRCm39) D56G probably damaging Het
Tanc2 T A 11: 105,814,293 (GRCm39) N1912K probably damaging Het
Tmcc1 T C 6: 116,001,843 (GRCm39) I559V Het
Tnfaip3 A G 10: 18,880,528 (GRCm39) V513A probably benign Het
Ucp3 T C 7: 100,131,799 (GRCm39) F217L probably benign Het
Zc3h11a A T 1: 133,573,475 (GRCm39) M55K probably damaging Het
Zfp316 G A 5: 143,249,167 (GRCm39) T156I unknown Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGACTGCCAAAAGATC -3'
(R):5'- TCTTCAAAGAGGCCATGATGG -3'

Sequencing Primer
(F):5'- AGATCAAGTTCCTGTAGTCCCAG -3'
(R):5'- GGAGACATGCTGGTCCTTCCTAC -3'
Posted On 2019-11-12