Incidental Mutation 'R7693:Ucp3'
ID593497
Institutional Source Beutler Lab
Gene Symbol Ucp3
Ensembl Gene ENSMUSG00000032942
Gene Nameuncoupling protein 3 (mitochondrial, proton carrier)
SynonymsUCP-3, Slc25a9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location100472990-100486432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100482592 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 217 (F217L)
Ref Sequence ENSEMBL: ENSMUSP00000032958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]
Predicted Effect probably benign
Transcript: ENSMUST00000032958
AA Change: F217L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: F217L

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 3.1e-20 PFAM
Pfam:Mito_carr 109 207 9.6e-26 PFAM
Pfam:Mito_carr 210 301 2.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107059
AA Change: F217L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: F217L

DomainStartEndE-ValueType
Pfam:Mito_carr 9 107 5.9e-22 PFAM
Pfam:Mito_carr 109 207 1.7e-27 PFAM
Pfam:Mito_carr 209 301 9.4e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Ucp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Ucp3 APN 7 100480559 missense probably damaging 1.00
IGL02883:Ucp3 APN 7 100480642 missense probably benign 0.00
IGL03137:Ucp3 APN 7 100482762 splice site probably benign
PIT4576001:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0532:Ucp3 UTSW 7 100481979 splice site probably benign
R0616:Ucp3 UTSW 7 100480161 missense probably benign 0.00
R0833:Ucp3 UTSW 7 100479541 nonsense probably null
R1739:Ucp3 UTSW 7 100482720 missense probably benign 0.01
R1939:Ucp3 UTSW 7 100480664 missense probably benign 0.00
R3861:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R3958:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R3959:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R4059:Ucp3 UTSW 7 100482664 missense probably damaging 0.99
R5535:Ucp3 UTSW 7 100480666 missense probably benign 0.45
R6463:Ucp3 UTSW 7 100480269 missense probably benign 0.00
R6596:Ucp3 UTSW 7 100481933 missense probably benign 0.01
R7517:Ucp3 UTSW 7 100481882 missense probably damaging 1.00
Z1177:Ucp3 UTSW 7 100480592 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CACAGTGAGGTCATCTGCAC -3'
(R):5'- GTGACAGCTTACCCTTTGTAGAAG -3'

Sequencing Primer
(F):5'- GTGAGGTCATCTGCACCACAC -3'
(R):5'- TGTAGAAGGCCGTGGGTCC -3'
Posted On2019-11-12