Incidental Mutation 'R7693:Ucp3'
ID 593497
Institutional Source Beutler Lab
Gene Symbol Ucp3
Ensembl Gene ENSMUSG00000032942
Gene Name uncoupling protein 3 (mitochondrial, proton carrier)
Synonyms Slc25a9, UCP-3
MMRRC Submission 045708-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R7693 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 100122198-100135639 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100131799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 217 (F217L)
Ref Sequence ENSEMBL: ENSMUSP00000032958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]
AlphaFold P56501
Predicted Effect probably benign
Transcript: ENSMUST00000032958
AA Change: F217L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: F217L

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 3.1e-20 PFAM
Pfam:Mito_carr 109 207 9.6e-26 PFAM
Pfam:Mito_carr 210 301 2.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107059
AA Change: F217L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: F217L

DomainStartEndE-ValueType
Pfam:Mito_carr 9 107 5.9e-22 PFAM
Pfam:Mito_carr 109 207 1.7e-27 PFAM
Pfam:Mito_carr 209 301 9.4e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,827,968 (GRCm39) S63I probably damaging Het
Adcy10 A G 1: 165,398,340 (GRCm39) E1479G probably benign Het
Alpl C T 4: 137,471,120 (GRCm39) G339R probably damaging Het
Anapc1 A G 2: 128,483,457 (GRCm39) S1213P possibly damaging Het
Aoc3 C A 11: 101,223,338 (GRCm39) H525N probably benign Het
Arhgap33 A T 7: 30,225,537 (GRCm39) probably null Het
Arhgef4 A G 1: 34,763,222 (GRCm39) E826G probably benign Het
Art2a A T 7: 101,204,056 (GRCm39) *161R probably null Het
Azi2 A T 9: 117,876,661 (GRCm39) N59I probably damaging Het
Cdhr5 T C 7: 140,851,691 (GRCm39) T538A probably benign Het
Cilk1 A G 9: 78,065,008 (GRCm39) D306G probably benign Het
Csnk2b C A 17: 35,336,972 (GRCm39) G123C probably null Het
Dnaaf10 T C 11: 17,162,064 (GRCm39) V34A probably benign Het
Dnaja2 G T 8: 86,266,939 (GRCm39) P306Q probably damaging Het
Dusp19 A G 2: 80,447,905 (GRCm39) T60A probably benign Het
Epm2aip1 G A 9: 111,101,443 (GRCm39) G139S probably benign Het
Fer1l4 A G 2: 155,862,351 (GRCm39) F1774S possibly damaging Het
Fxyd3 T A 7: 30,770,598 (GRCm39) R66S probably benign Het
Gjd2 T C 2: 113,842,309 (GRCm39) N56S probably damaging Het
Gmcl1 A G 6: 86,691,239 (GRCm39) I252T probably benign Het
Gnl1 T C 17: 36,299,112 (GRCm39) C517R probably damaging Het
Grin1 T A 2: 25,208,679 (GRCm39) M74L possibly damaging Het
Hinfp A G 9: 44,209,642 (GRCm39) M244T probably damaging Het
Iqca1l T C 5: 24,751,626 (GRCm39) I541V probably benign Het
Kcnma1 T A 14: 23,417,680 (GRCm39) I850F probably damaging Het
Kif13a G T 13: 46,904,089 (GRCm39) T1748N probably benign Het
Lama1 C T 17: 68,124,026 (GRCm39) A2817V Het
Map6 C T 7: 98,985,499 (GRCm39) L671F possibly damaging Het
Neb C T 2: 52,189,581 (GRCm39) A770T probably damaging Het
Noc2l T A 4: 156,324,764 (GRCm39) H280Q probably damaging Het
Ntrk1 T C 3: 87,695,733 (GRCm39) D205G probably benign Het
Or5m5 A T 2: 85,814,979 (GRCm39) Y265F probably damaging Het
Or7a37 A T 10: 78,806,137 (GRCm39) Y218F probably damaging Het
Parp9 A G 16: 35,777,282 (GRCm39) S409G possibly damaging Het
Pcnx2 G A 8: 126,613,864 (GRCm39) T529I probably benign Het
Popdc3 A G 10: 45,191,227 (GRCm39) S113G probably benign Het
Rbm8a T C 3: 96,537,624 (GRCm39) I25T probably damaging Het
Rfc4 A G 16: 22,946,163 (GRCm39) W40R probably damaging Het
Rp1 T C 1: 4,417,626 (GRCm39) D1162G probably damaging Het
Slc14a2 G A 18: 78,197,218 (GRCm39) A846V possibly damaging Het
Spx A G 6: 142,360,516 (GRCm39) D56G probably damaging Het
Tanc2 T A 11: 105,814,293 (GRCm39) N1912K probably damaging Het
Tmcc1 T C 6: 116,001,843 (GRCm39) I559V Het
Tnfaip3 A G 10: 18,880,528 (GRCm39) V513A probably benign Het
Zc3h11a A T 1: 133,573,475 (GRCm39) M55K probably damaging Het
Zfp316 G A 5: 143,249,167 (GRCm39) T156I unknown Het
Other mutations in Ucp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Ucp3 APN 7 100,129,766 (GRCm39) missense probably damaging 1.00
IGL02883:Ucp3 APN 7 100,129,849 (GRCm39) missense probably benign 0.00
IGL03137:Ucp3 APN 7 100,131,969 (GRCm39) splice site probably benign
PIT4576001:Ucp3 UTSW 7 100,129,458 (GRCm39) missense probably benign 0.04
R0023:Ucp3 UTSW 7 100,134,250 (GRCm39) missense probably benign 0.00
R0023:Ucp3 UTSW 7 100,134,250 (GRCm39) missense probably benign 0.00
R0532:Ucp3 UTSW 7 100,131,186 (GRCm39) splice site probably benign
R0616:Ucp3 UTSW 7 100,129,368 (GRCm39) missense probably benign 0.00
R0833:Ucp3 UTSW 7 100,128,748 (GRCm39) nonsense probably null
R1739:Ucp3 UTSW 7 100,131,927 (GRCm39) missense probably benign 0.01
R1939:Ucp3 UTSW 7 100,129,871 (GRCm39) missense probably benign 0.00
R3861:Ucp3 UTSW 7 100,129,458 (GRCm39) missense probably benign 0.04
R3958:Ucp3 UTSW 7 100,131,946 (GRCm39) missense probably benign 0.00
R3959:Ucp3 UTSW 7 100,131,946 (GRCm39) missense probably benign 0.00
R4059:Ucp3 UTSW 7 100,131,871 (GRCm39) missense probably damaging 0.99
R5535:Ucp3 UTSW 7 100,129,873 (GRCm39) missense probably benign 0.45
R6463:Ucp3 UTSW 7 100,129,476 (GRCm39) missense probably benign 0.00
R6596:Ucp3 UTSW 7 100,131,140 (GRCm39) missense probably benign 0.01
R7517:Ucp3 UTSW 7 100,131,089 (GRCm39) missense probably damaging 1.00
R9487:Ucp3 UTSW 7 100,131,123 (GRCm39) missense probably damaging 1.00
R9493:Ucp3 UTSW 7 100,131,911 (GRCm39) missense probably benign 0.00
Z1177:Ucp3 UTSW 7 100,129,799 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CACAGTGAGGTCATCTGCAC -3'
(R):5'- GTGACAGCTTACCCTTTGTAGAAG -3'

Sequencing Primer
(F):5'- GTGAGGTCATCTGCACCACAC -3'
(R):5'- TGTAGAAGGCCGTGGGTCC -3'
Posted On 2019-11-12