Incidental Mutation 'R7693:Cdhr5'
ID593499
Institutional Source Beutler Lab
Gene Symbol Cdhr5
Ensembl Gene ENSMUSG00000025497
Gene Namecadherin-related family member 5
Synonyms1810074H01Rik, Mupcdh, Mucdhl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141269083-141276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141271778 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 538 (T538A)
Ref Sequence ENSEMBL: ENSMUSP00000127292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080654] [ENSMUST00000167263] [ENSMUST00000210124] [ENSMUST00000210773]
Predicted Effect probably benign
Transcript: ENSMUST00000080654
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167263
AA Change: T538A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497
AA Change: T538A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210124
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Cdhr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Cdhr5 APN 7 141269981 missense probably damaging 0.99
IGL02662:Cdhr5 APN 7 141274503 missense possibly damaging 0.57
R0002:Cdhr5 UTSW 7 141270020 splice site probably null
R0098:Cdhr5 UTSW 7 141269868 missense probably damaging 1.00
R0201:Cdhr5 UTSW 7 141276378 missense probably damaging 1.00
R0494:Cdhr5 UTSW 7 141272518 missense probably damaging 1.00
R0508:Cdhr5 UTSW 7 141272899 missense probably benign 0.41
R0918:Cdhr5 UTSW 7 141272149 missense probably damaging 1.00
R1570:Cdhr5 UTSW 7 141271769 missense probably damaging 1.00
R1571:Cdhr5 UTSW 7 141272170 missense probably damaging 1.00
R1838:Cdhr5 UTSW 7 141272603 missense possibly damaging 0.93
R3912:Cdhr5 UTSW 7 141273857 missense probably damaging 1.00
R4289:Cdhr5 UTSW 7 141272839 missense probably damaging 0.99
R4491:Cdhr5 UTSW 7 141274057 missense possibly damaging 0.55
R4838:Cdhr5 UTSW 7 141273731 missense probably damaging 1.00
R4949:Cdhr5 UTSW 7 141272644 missense probably damaging 0.97
R5187:Cdhr5 UTSW 7 141274448 missense probably damaging 1.00
R5344:Cdhr5 UTSW 7 141276524 missense probably damaging 0.97
R5642:Cdhr5 UTSW 7 141269197 nonsense probably null
R6736:Cdhr5 UTSW 7 141272531 missense probably damaging 0.97
R7172:Cdhr5 UTSW 7 141271928 missense possibly damaging 0.90
R7212:Cdhr5 UTSW 7 141272659 missense probably damaging 0.99
R8397:Cdhr5 UTSW 7 141271888 missense possibly damaging 0.87
RF016:Cdhr5 UTSW 7 141272184 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACTGAGAGGTTCCTGGCTTG -3'
(R):5'- GGGCCTTCAAGTAACACCAC -3'

Sequencing Primer
(F):5'- TGGTGAGCTGCCACTAGG -3'
(R):5'- CACTATGGAAGCCCCCTTG -3'
Posted On2019-11-12