Incidental Mutation 'R7693:Epm2aip1'
ID593504
Institutional Source Beutler Lab
Gene Symbol Epm2aip1
Ensembl Gene ENSMUSG00000046785
Gene NameEPM2A (laforin) interacting protein 1
SynonymsA930003G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location111271929-111279093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111272375 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 139 (G139S)
Ref Sequence ENSEMBL: ENSMUSP00000120245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035079] [ENSMUST00000060711] [ENSMUST00000135218] [ENSMUST00000135807]
Predicted Effect probably benign
Transcript: ENSMUST00000035079
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060711
AA Change: G139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000135218
Predicted Effect probably benign
Transcript: ENSMUST00000135807
AA Change: G139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The EPM2A gene, which encodes laforin, is mutated in an autosomal recessive form of adolescent progressive myoclonus epilepsy. The protein encoded by this gene binds to laforin, but its function is not known. This gene is intronless. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased anxiety-related response, decreased liver glycogen storage and synthesis, hepatic steatosis, improved glucose tolerance and decreased hepatic insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Epm2aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Epm2aip1 APN 9 111272787 missense possibly damaging 0.89
IGL01309:Epm2aip1 APN 9 111273528 missense probably benign 0.01
IGL02815:Epm2aip1 APN 9 111273560 missense probably benign
Lafora UTSW 9 111272556 missense probably damaging 1.00
R0066:Epm2aip1 UTSW 9 111272463 missense probably benign
R0066:Epm2aip1 UTSW 9 111272463 missense probably benign
R0548:Epm2aip1 UTSW 9 111273341 missense probably damaging 1.00
R0854:Epm2aip1 UTSW 9 111272499 nonsense probably null
R1497:Epm2aip1 UTSW 9 111272247 missense possibly damaging 0.92
R4012:Epm2aip1 UTSW 9 111272390 missense probably benign 0.41
R4722:Epm2aip1 UTSW 9 111272084 small deletion probably benign
R4741:Epm2aip1 UTSW 9 111272613 missense probably benign 0.06
R4834:Epm2aip1 UTSW 9 111273194 missense probably benign 0.13
R5037:Epm2aip1 UTSW 9 111272150 missense probably benign 0.00
R5045:Epm2aip1 UTSW 9 111273359 missense possibly damaging 0.95
R5174:Epm2aip1 UTSW 9 111273387 missense probably damaging 1.00
R6822:Epm2aip1 UTSW 9 111272556 missense probably damaging 1.00
R7262:Epm2aip1 UTSW 9 111272660 missense probably benign 0.01
R7472:Epm2aip1 UTSW 9 111272399 missense probably damaging 1.00
R7860:Epm2aip1 UTSW 9 111272037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTGACATGTCTTTGGC -3'
(R):5'- AGTCAGGTTGATAATCGTCAGAAG -3'

Sequencing Primer
(F):5'- ACATGTCTTTGGCCGCCG -3'
(R):5'- AGAAGATCTTCTTGCACCTCCAGG -3'
Posted On2019-11-12