Incidental Mutation 'R7693:Tnfaip3'
ID593506
Institutional Source Beutler Lab
Gene Symbol Tnfaip3
Ensembl Gene ENSMUSG00000019850
Gene Nametumor necrosis factor, alpha-induced protein 3
SynonymsA20, zinc finger protein A20, Tnfip3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location19000910-19015657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19004780 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 513 (V513A)
Ref Sequence ENSEMBL: ENSMUSP00000019997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019997] [ENSMUST00000105527] [ENSMUST00000122863]
Predicted Effect probably benign
Transcript: ENSMUST00000019997
AA Change: V513A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019997
Gene: ENSMUSG00000019850
AA Change: V513A

DomainStartEndE-ValueType
Pfam:OTU 98 257 1.2e-30 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105527
AA Change: V513A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101167
Gene: ENSMUSG00000019850
AA Change: V513A

DomainStartEndE-ValueType
Pfam:OTU 98 257 7.8e-34 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122863
SMART Domains Protein: ENSMUSP00000116318
Gene: ENSMUSG00000019850

DomainStartEndE-ValueType
PDB:2VFJ|D 1 122 2e-83 PDB
SCOP:d1e3ha3 18 109 2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Tnfaip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
lasvegas APN 10 19010758 unclassified probably benign
IGL00840:Tnfaip3 APN 10 19005126 missense probably damaging 1.00
IGL00966:Tnfaip3 APN 10 19005137 missense probably damaging 1.00
IGL01080:Tnfaip3 APN 10 19011655 missense probably benign 0.03
IGL01736:Tnfaip3 APN 10 19006901 missense probably damaging 1.00
IGL02318:Tnfaip3 APN 10 19004467 missense probably benign 0.04
IGL02703:Tnfaip3 APN 10 19007032 missense probably damaging 0.98
IGL03032:Tnfaip3 APN 10 19004609 missense probably benign
IGL03331:Tnfaip3 APN 10 19011601 missense possibly damaging 0.63
IGL03389:Tnfaip3 APN 10 19004987 missense probably benign 0.03
PIT4243001:Tnfaip3 UTSW 10 19011574 missense probably damaging 1.00
PIT4480001:Tnfaip3 UTSW 10 19007323 missense probably benign
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0056:Tnfaip3 UTSW 10 19005293 missense probably damaging 1.00
R0195:Tnfaip3 UTSW 10 19005713 missense probably damaging 1.00
R0226:Tnfaip3 UTSW 10 19002747 missense probably damaging 1.00
R0369:Tnfaip3 UTSW 10 19006912 nonsense probably null
R0744:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R0833:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1876:Tnfaip3 UTSW 10 19004934 missense possibly damaging 0.81
R1902:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1903:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1922:Tnfaip3 UTSW 10 19003607 missense possibly damaging 0.51
R1973:Tnfaip3 UTSW 10 19004504 missense probably damaging 0.98
R2040:Tnfaip3 UTSW 10 19008152 missense possibly damaging 0.89
R2513:Tnfaip3 UTSW 10 19005659 missense probably benign 0.00
R2936:Tnfaip3 UTSW 10 19011609 missense probably damaging 1.00
R3607:Tnfaip3 UTSW 10 19005602 missense probably damaging 1.00
R4386:Tnfaip3 UTSW 10 19007010 missense probably damaging 1.00
R4483:Tnfaip3 UTSW 10 19011627 missense probably damaging 1.00
R4673:Tnfaip3 UTSW 10 19011832 intron probably benign
R4879:Tnfaip3 UTSW 10 19005573 missense probably benign 0.03
R5082:Tnfaip3 UTSW 10 19005284 missense probably damaging 1.00
R5524:Tnfaip3 UTSW 10 19008195 missense probably damaging 0.98
R6559:Tnfaip3 UTSW 10 19007248 missense probably damaging 1.00
R6776:Tnfaip3 UTSW 10 19005576 missense probably benign 0.02
R6853:Tnfaip3 UTSW 10 19003751 missense probably benign
R6891:Tnfaip3 UTSW 10 19011669 missense probably damaging 1.00
R7144:Tnfaip3 UTSW 10 19007281 missense probably benign 0.00
R8155:Tnfaip3 UTSW 10 19004691 missense possibly damaging 0.78
R8377:Tnfaip3 UTSW 10 19011510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCAGTCCGGTGGCAAG -3'
(R):5'- GACTTGGCTCCTCAAACTGG -3'

Sequencing Primer
(F):5'- CCGGTGGCAAGAGTGTG -3'
(R):5'- AACCGCTGGAGGACCTCATTC -3'
Posted On2019-11-12