Incidental Mutation 'R7693:Popdc3'
ID593507
Institutional Source Beutler Lab
Gene Symbol Popdc3
Ensembl Gene ENSMUSG00000019848
Gene Namepopeye domain containing 3
SynonymsPop3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location45178098-45318452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45315131 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 113 (S113G)
Ref Sequence ENSEMBL: ENSMUSP00000019994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019994] [ENSMUST00000161803] [ENSMUST00000175658]
Predicted Effect probably benign
Transcript: ENSMUST00000019994
AA Change: S113G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000019994
Gene: ENSMUSG00000019848
AA Change: S113G

DomainStartEndE-ValueType
Pfam:Popeye 25 249 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161803
AA Change: S113G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125532
Gene: ENSMUSG00000019848
AA Change: S113G

DomainStartEndE-ValueType
transmembrane domain 27 44 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Popeye 107 169 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175658
SMART Domains Protein: ENSMUSP00000135373
Gene: ENSMUSG00000019848

DomainStartEndE-ValueType
transmembrane domain 27 44 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in these tissues during development. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Csnk2b C A 17: 35,117,996 G123C probably null Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Popdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Popdc3 APN 10 45317826 splice site probably null
IGL01304:Popdc3 APN 10 45317909 missense probably benign
IGL01643:Popdc3 APN 10 45314880 missense probably damaging 1.00
IGL02755:Popdc3 APN 10 45315218 missense probably damaging 1.00
R0410:Popdc3 UTSW 10 45317733 missense possibly damaging 0.95
R0586:Popdc3 UTSW 10 45315263 missense probably benign 0.04
R0738:Popdc3 UTSW 10 45315258 missense probably damaging 1.00
R1102:Popdc3 UTSW 10 45316546 unclassified probably benign
R1649:Popdc3 UTSW 10 45315224 missense probably damaging 1.00
R2026:Popdc3 UTSW 10 45314855 missense probably damaging 1.00
R4720:Popdc3 UTSW 10 45314906 missense probably benign 0.04
R5669:Popdc3 UTSW 10 45316433 missense probably damaging 1.00
R5905:Popdc3 UTSW 10 45317919 missense probably benign
R6028:Popdc3 UTSW 10 45317919 missense probably benign
R7468:Popdc3 UTSW 10 45315021 missense probably damaging 1.00
R7864:Popdc3 UTSW 10 45315182 missense probably benign 0.13
X0057:Popdc3 UTSW 10 45315111 missense probably benign 0.10
Z1177:Popdc3 UTSW 10 45314884 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGGATTCTTTGGGCTCC -3'
(R):5'- CAGGACTATGCTGCACCAAC -3'

Sequencing Primer
(F):5'- GGGCTCCTTTATGTCTTCAGC -3'
(R):5'- CCACTACAGAGGTGAGGCAC -3'
Posted On2019-11-12