Incidental Mutation 'R7693:Csnk2b'
ID593516
Institutional Source Beutler Lab
Gene Symbol Csnk2b
Ensembl Gene ENSMUSG00000024387
Gene Namecasein kinase 2, beta polypeptide
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7693 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35116196-35122053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35117996 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 123 (G123C)
Ref Sequence ENSEMBL: ENSMUSP00000134218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025246] [ENSMUST00000052167] [ENSMUST00000062657] [ENSMUST00000165306] [ENSMUST00000172765] [ENSMUST00000172854] [ENSMUST00000173043] [ENSMUST00000173114] [ENSMUST00000173380] [ENSMUST00000173915] [ENSMUST00000174024] [ENSMUST00000174306] [ENSMUST00000174779]
Predicted Effect probably null
Transcript: ENSMUST00000025246
AA Change: G123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025246
Gene: ENSMUSG00000024387
AA Change: G123C

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052167
SMART Domains Protein: ENSMUSP00000056646
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 82 99 N/A INTRINSIC
ANK 156 186 4.36e-1 SMART
G_patch 269 315 1.45e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062657
SMART Domains Protein: ENSMUSP00000052133
Gene: ENSMUSG00000043807

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CK_II_beta 21 115 1e-40 BLAST
Blast:CK_II_beta 125 170 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165306
SMART Domains Protein: ENSMUSP00000133240
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 4.36e-1 SMART
G_patch 246 292 1.45e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172765
AA Change: G144C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134523
Gene: ENSMUSG00000024387
AA Change: G144C

DomainStartEndE-ValueType
CK_II_beta 29 206 6.86e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172854
SMART Domains Protein: ENSMUSP00000138033
Gene: ENSMUSG00000043807

DomainStartEndE-ValueType
Blast:CK_II_beta 1 60 2e-18 BLAST
Blast:CK_II_beta 70 115 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173043
SMART Domains Protein: ENSMUSP00000135684
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 2.7e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173114
AA Change: G123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134218
Gene: ENSMUSG00000024387
AA Change: G123C

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173380
SMART Domains Protein: ENSMUSP00000134694
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173633
AA Change: G26C
SMART Domains Protein: ENSMUSP00000133826
Gene: ENSMUSG00000024387
AA Change: G26C

DomainStartEndE-ValueType
CK_II_beta 2 91 1.28e-26 SMART
Blast:CK_II_beta 121 154 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173915
SMART Domains Protein: ENSMUSP00000133425
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 58 6.45e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174024
AA Change: G123W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134673
Gene: ENSMUSG00000024387
AA Change: G123W

DomainStartEndE-ValueType
CK_II_beta 8 169 5.07e-71 SMART
Blast:CK_II_beta 189 220 6e-7 BLAST
Predicted Effect silent
Transcript: ENSMUST00000174306
SMART Domains Protein: ENSMUSP00000134413
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 122 3.01e-64 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174779
AA Change: G72C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133684
Gene: ENSMUSG00000024387
AA Change: G72C

DomainStartEndE-ValueType
CK_II_beta 1 140 2.47e-83 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the casein kinase 2 enzyme, which is a heterotetramer comprised of alpha and/or alpha-prime catalytic subunits and two regulatory beta subunits. Casein kinase 2 is involved in the regulation of several cellular processes including gene expression, protein synthesis and cell proliferation. Knockout of this gene in mice leads to embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality post-implantation, growth retardation and arrest, a failure to form an inner cell mass and smaller size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,546,628 I541V probably benign Het
Abcc8 C A 7: 46,178,544 S63I probably damaging Het
Adcy10 A G 1: 165,570,771 E1479G probably benign Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Anapc1 A G 2: 128,641,537 S1213P possibly damaging Het
Aoc3 C A 11: 101,332,512 H525N probably benign Het
Arhgap33 A T 7: 30,526,112 probably null Het
Arhgef4 A G 1: 34,724,141 E826G probably benign Het
Art2a-ps A T 7: 101,554,849 *161R probably null Het
Azi2 A T 9: 118,047,593 N59I probably damaging Het
Cdhr5 T C 7: 141,271,778 T538A probably benign Het
Dnaja2 G T 8: 85,540,310 P306Q probably damaging Het
Dusp19 A G 2: 80,617,561 T60A probably benign Het
Epm2aip1 G A 9: 111,272,375 G139S probably benign Het
Fer1l4 A G 2: 156,020,431 F1774S possibly damaging Het
Fxyd3 T A 7: 31,071,173 R66S probably benign Het
Gjd2 T C 2: 114,011,828 N56S probably damaging Het
Gmcl1 A G 6: 86,714,257 I252T probably benign Het
Gnl1 T C 17: 35,988,220 C517R probably damaging Het
Grin1 T A 2: 25,318,667 M74L possibly damaging Het
Hinfp A G 9: 44,298,345 M244T probably damaging Het
Ick A G 9: 78,157,726 D306G probably benign Het
Kcnma1 T A 14: 23,367,612 I850F probably damaging Het
Kif13a G T 13: 46,750,613 T1748N probably benign Het
Lama1 C T 17: 67,817,031 A2817V Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Neb C T 2: 52,299,569 A770T probably damaging Het
Noc2l T A 4: 156,240,307 H280Q probably damaging Het
Ntrk1 T C 3: 87,788,426 D205G probably benign Het
Olfr1030 A T 2: 85,984,635 Y265F probably damaging Het
Olfr1353 A T 10: 78,970,303 Y218F probably damaging Het
Parp9 A G 16: 35,956,912 S409G possibly damaging Het
Pcnx2 G A 8: 125,887,125 T529I probably benign Het
Popdc3 A G 10: 45,315,131 S113G probably benign Het
Rbm8a T C 3: 96,630,308 I25T probably damaging Het
Rfc4 A G 16: 23,127,413 W40R probably damaging Het
Rp1 T C 1: 4,347,403 D1162G probably damaging Het
Slc14a2 G A 18: 78,154,003 A846V possibly damaging Het
Spx A G 6: 142,414,790 D56G probably damaging Het
Tanc2 T A 11: 105,923,467 N1912K probably damaging Het
Tmcc1 T C 6: 116,024,882 I559V Het
Tnfaip3 A G 10: 19,004,780 V513A probably benign Het
Ucp3 T C 7: 100,482,592 F217L probably benign Het
Wdr92 T C 11: 17,212,064 V34A probably benign Het
Zc3h11a A T 1: 133,645,737 M55K probably damaging Het
Zfp316 G A 5: 143,263,412 T156I unknown Het
Other mutations in Csnk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Csnk2b APN 17 35118016 missense possibly damaging 0.92
R2318:Csnk2b UTSW 17 35118061 missense possibly damaging 0.88
R6966:Csnk2b UTSW 17 35117782 missense probably benign
R7053:Csnk2b UTSW 17 35116446 intron probably benign
R7812:Csnk2b UTSW 17 35120455 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GAGGACTTGGGTGTGTACAC -3'
(R):5'- TGAGTTTGAGGACCTATCTCGAC -3'

Sequencing Primer
(F):5'- GTGTACACGTCCATGCACTTGG -3'
(R):5'- AGGGAGACTTTGGCTACT -3'
Posted On2019-11-12