Incidental Mutation 'R7694:Fhad1'
ID593535
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7694 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141905064 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1255 (K1255E)
Ref Sequence ENSEMBL: ENSMUSP00000101405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably benign
Transcript: ENSMUST00000105779
AA Change: K1255E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: K1255E

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105780
AA Change: K1255E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: K1255E

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T G 17: 13,888,882 S1571A probably damaging Het
Agbl1 C A 7: 76,698,765 A870D unknown Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Ankrd55 T C 13: 112,367,964 Y415H probably damaging Het
Cd69 G A 6: 129,270,045 R111C possibly damaging Het
Cdh26 A T 2: 178,460,103 T172S probably damaging Het
Cflar T A 1: 58,752,807 V423E Het
Cgrrf1 A C 14: 46,853,958 Q313P possibly damaging Het
Chga G A 12: 102,561,347 A87T probably benign Het
Chrna4 T A 2: 181,018,593 D102V Het
Cpvl A T 6: 53,932,517 Y211* probably null Het
Cyp26a1 G A 19: 37,701,064 D403N possibly damaging Het
Dchs2 T C 3: 83,129,482 L512P probably damaging Het
Dll3 A C 7: 28,301,745 M1R probably null Het
Dnah12 A G 14: 26,781,380 T1564A probably damaging Het
Efhb A G 17: 53,400,808 S776P probably damaging Het
Eml5 T C 12: 98,792,563 S1831G probably damaging Het
Fat1 G T 8: 44,988,930 probably null Het
Fitm2 C T 2: 163,469,972 C107Y probably damaging Het
Gdpd4 T C 7: 97,971,939 V153A probably benign Het
Ggnbp2 A G 11: 84,860,713 V87A possibly damaging Het
Glb1l G T 1: 75,201,792 A334E probably damaging Het
Gnas T G 2: 174,300,212 L784R probably damaging Het
Gtf2i C T 5: 134,282,805 E223K probably damaging Het
H2-M10.5 T C 17: 36,773,749 Y122H probably damaging Het
Hikeshi G A 7: 89,930,346 Q6* probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Irak2 A C 6: 113,690,898 D528A probably damaging Het
Lcn2 A G 2: 32,388,030 C17R unknown Het
Lcp2 G T 11: 34,050,924 V36L probably benign Het
Lin7c T C 2: 109,896,272 S89P probably benign Het
Lrrc37a C T 11: 103,504,378 A74T probably benign Het
Lrrtm3 T A 10: 64,088,039 M450L probably benign Het
Lsm11 C T 11: 45,933,941 R253Q probably benign Het
Map9 A T 3: 82,358,983 probably benign Het
Mmp2 T A 8: 92,831,730 D142E possibly damaging Het
Nrn1l A T 8: 105,894,798 T127S probably damaging Het
Olfr310 T C 7: 86,269,775 T5A probably damaging Het
Pelp1 G A 11: 70,394,759 T761I probably damaging Het
Pmm2 T A 16: 8,645,390 V63E probably damaging Het
Ptprb T A 10: 116,372,948 L1942H probably damaging Het
Ptprk T A 10: 28,589,370 C1350S possibly damaging Het
Rnf44 A G 13: 54,682,028 V381A probably damaging Het
Robo3 G A 9: 37,418,520 P1167S probably benign Het
Ryk A G 9: 102,898,780 E489G probably damaging Het
Satb2 T A 1: 56,871,524 I321L probably benign Het
Sh2b1 A T 7: 126,467,757 V655E probably benign Het
Slc16a12 G A 19: 34,670,635 T486M probably damaging Het
Slc34a1 G T 13: 55,413,408 R562L probably benign Het
Slc4a9 A G 18: 36,536,849 E779G probably damaging Het
Strc C A 2: 121,377,096 C598F probably damaging Het
Stxbp6 A T 12: 44,902,027 F100I probably damaging Het
Tap2 A G 17: 34,205,697 T135A probably benign Het
Tmcc1 G A 6: 116,133,844 P159S Het
Tmem106b T A 6: 13,078,106 M100K probably benign Het
Ttn T A 2: 76,747,695 T24285S probably damaging Het
Vmn1r116 G A 7: 20,872,412 V53M possibly damaging Het
Zar1 A T 5: 72,580,850 S70T probably benign Het
Zfp235 C T 7: 24,142,100 T648M probably benign Het
Zfp937 C T 2: 150,239,348 H433Y probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGCCTGCACATTGAGAGC -3'
(R):5'- TCAGACACCAGCATTCCAGTG -3'

Sequencing Primer
(F):5'- TAGAGAGGCATGGTCCTCC -3'
(R):5'- AGCATTCCAGTGGCCTCGTG -3'
Posted On2019-11-12