Incidental Mutation 'R7694:Idh2'
ID593547
Institutional Source Beutler Lab
Gene Symbol Idh2
Ensembl Gene ENSMUSG00000030541
Gene Nameisocitrate dehydrogenase 2 (NADP+), mitochondrial
SynonymsIdh-2, IDPm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7694 (G1)
Quality Score217.471
Status Not validated
Chromosome7
Chromosomal Location80094846-80115392 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) TCCCAGG to T at 80098331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107384] [ENSMUST00000125542] [ENSMUST00000134328] [ENSMUST00000164056] [ENSMUST00000206714]
Predicted Effect probably benign
Transcript: ENSMUST00000107384
SMART Domains Protein: ENSMUSP00000103007
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 441 5.32e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134070
Predicted Effect probably benign
Transcript: ENSMUST00000134328
SMART Domains Protein: ENSMUSP00000118184
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 284 1.59e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156761
Predicted Effect probably benign
Transcript: ENSMUST00000164056
SMART Domains Protein: ENSMUSP00000132361
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206714
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit suppression of tumorigenesis from B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T G 17: 13,888,882 S1571A probably damaging Het
Agbl1 C A 7: 76,698,765 A870D unknown Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Ankrd55 T C 13: 112,367,964 Y415H probably damaging Het
Cd69 G A 6: 129,270,045 R111C possibly damaging Het
Cdh26 A T 2: 178,460,103 T172S probably damaging Het
Cflar T A 1: 58,752,807 V423E Het
Cgrrf1 A C 14: 46,853,958 Q313P possibly damaging Het
Chga G A 12: 102,561,347 A87T probably benign Het
Chrna4 T A 2: 181,018,593 D102V Het
Cpvl A T 6: 53,932,517 Y211* probably null Het
Cyp26a1 G A 19: 37,701,064 D403N possibly damaging Het
Dchs2 T C 3: 83,129,482 L512P probably damaging Het
Dll3 A C 7: 28,301,745 M1R probably null Het
Dnah12 A G 14: 26,781,380 T1564A probably damaging Het
Efhb A G 17: 53,400,808 S776P probably damaging Het
Eml5 T C 12: 98,792,563 S1831G probably damaging Het
Fat1 G T 8: 44,988,930 probably null Het
Fhad1 T C 4: 141,905,064 K1255E probably benign Het
Fitm2 C T 2: 163,469,972 C107Y probably damaging Het
Gdpd4 T C 7: 97,971,939 V153A probably benign Het
Ggnbp2 A G 11: 84,860,713 V87A possibly damaging Het
Glb1l G T 1: 75,201,792 A334E probably damaging Het
Gnas T G 2: 174,300,212 L784R probably damaging Het
Gtf2i C T 5: 134,282,805 E223K probably damaging Het
H2-M10.5 T C 17: 36,773,749 Y122H probably damaging Het
Hikeshi G A 7: 89,930,346 Q6* probably null Het
Irak2 A C 6: 113,690,898 D528A probably damaging Het
Lcn2 A G 2: 32,388,030 C17R unknown Het
Lcp2 G T 11: 34,050,924 V36L probably benign Het
Lin7c T C 2: 109,896,272 S89P probably benign Het
Lrrc37a C T 11: 103,504,378 A74T probably benign Het
Lrrtm3 T A 10: 64,088,039 M450L probably benign Het
Lsm11 C T 11: 45,933,941 R253Q probably benign Het
Map9 A T 3: 82,358,983 probably benign Het
Mmp2 T A 8: 92,831,730 D142E possibly damaging Het
Nrn1l A T 8: 105,894,798 T127S probably damaging Het
Olfr310 T C 7: 86,269,775 T5A probably damaging Het
Pelp1 G A 11: 70,394,759 T761I probably damaging Het
Pmm2 T A 16: 8,645,390 V63E probably damaging Het
Ptprb T A 10: 116,372,948 L1942H probably damaging Het
Ptprk T A 10: 28,589,370 C1350S possibly damaging Het
Rnf44 A G 13: 54,682,028 V381A probably damaging Het
Robo3 G A 9: 37,418,520 P1167S probably benign Het
Ryk A G 9: 102,898,780 E489G probably damaging Het
Satb2 T A 1: 56,871,524 I321L probably benign Het
Sh2b1 A T 7: 126,467,757 V655E probably benign Het
Slc16a12 G A 19: 34,670,635 T486M probably damaging Het
Slc34a1 G T 13: 55,413,408 R562L probably benign Het
Slc4a9 A G 18: 36,536,849 E779G probably damaging Het
Strc C A 2: 121,377,096 C598F probably damaging Het
Stxbp6 A T 12: 44,902,027 F100I probably damaging Het
Tap2 A G 17: 34,205,697 T135A probably benign Het
Tmcc1 G A 6: 116,133,844 P159S Het
Tmem106b T A 6: 13,078,106 M100K probably benign Het
Ttn T A 2: 76,747,695 T24285S probably damaging Het
Vmn1r116 G A 7: 20,872,412 V53M possibly damaging Het
Zar1 A T 5: 72,580,850 S70T probably benign Het
Zfp235 C T 7: 24,142,100 T648M probably benign Het
Zfp937 C T 2: 150,239,348 H433Y probably damaging Het
Other mutations in Idh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Idh2 APN 7 80097945 missense probably benign
IGL02281:Idh2 APN 7 80095802 splice site probably null
IGL02874:Idh2 APN 7 80097873 missense probably damaging 1.00
IGL02892:Idh2 APN 7 80095670 missense probably benign
IGL02937:Idh2 APN 7 80098913 missense probably damaging 1.00
IGL02989:Idh2 APN 7 80099108 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0090:Idh2 UTSW 7 80097914 missense probably damaging 1.00
R0322:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0384:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0385:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0386:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0387:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0494:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R1603:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1681:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1711:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1844:Idh2 UTSW 7 80098877 missense probably benign 0.31
R3700:Idh2 UTSW 7 80099147 missense probably damaging 1.00
R4941:Idh2 UTSW 7 80096099 missense probably damaging 0.98
R5234:Idh2 UTSW 7 80096105 missense probably damaging 0.99
R5387:Idh2 UTSW 7 80098331 intron probably benign
R5582:Idh2 UTSW 7 80098339 frame shift probably null
R5655:Idh2 UTSW 7 80098248 missense probably damaging 0.99
R6191:Idh2 UTSW 7 80098331 intron probably benign
R6261:Idh2 UTSW 7 80098329 intron probably benign
R6311:Idh2 UTSW 7 80098331 intron probably benign
R6351:Idh2 UTSW 7 80098331 intron probably benign
R6413:Idh2 UTSW 7 80098331 intron probably benign
R6561:Idh2 UTSW 7 80098331 intron probably benign
R6709:Idh2 UTSW 7 80098331 intron probably benign
R6772:Idh2 UTSW 7 80098331 intron probably benign
R6781:Idh2 UTSW 7 80098331 intron probably benign
R6848:Idh2 UTSW 7 80098331 intron probably benign
R6861:Idh2 UTSW 7 80098218 missense probably damaging 1.00
R6899:Idh2 UTSW 7 80098331 intron probably benign
R7063:Idh2 UTSW 7 80095684 missense probably damaging 1.00
R7076:Idh2 UTSW 7 80098331 intron probably benign
R7081:Idh2 UTSW 7 80098329 intron probably benign
R7090:Idh2 UTSW 7 80098331 intron probably benign
R7254:Idh2 UTSW 7 80098331 frame shift probably null
R7298:Idh2 UTSW 7 80098331 intron probably benign
R7401:Idh2 UTSW 7 80098329 intron probably benign
R7560:Idh2 UTSW 7 80098331 frame shift probably null
R7561:Idh2 UTSW 7 80098331 intron probably benign
R7816:Idh2 UTSW 7 80098331 intron probably benign
R7884:Idh2 UTSW 7 80098329 intron probably benign
R7919:Idh2 UTSW 7 80098331 intron probably benign
R7961:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8009:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8036:Idh2 UTSW 7 80098331 intron probably benign
R8162:Idh2 UTSW 7 80098329 intron probably benign
R8321:Idh2 UTSW 7 80098331 intron probably benign
R8451:Idh2 UTSW 7 80098331 intron probably benign
R8501:Idh2 UTSW 7 80098331 intron probably benign
RF030:Idh2 UTSW 7 80098329 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGAAGCATCAGAGGTTGTTAC -3'
(R):5'- GCTTAAACAAGCCTGTACCAGC -3'

Sequencing Primer
(F):5'- GTCAAAGATCTCCTGGAAGATGTC -3'
(R):5'- GCCTGTACCAGCTATAAGGTCTAG -3'
Posted On2019-11-12