Incidental Mutation 'R7694:Olfr310'
ID593548
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7694 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86269775 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 5 (T5A)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably damaging
Transcript: ENSMUST00000081918
AA Change: T5A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: T5A

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217724
AA Change: T5A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T G 17: 13,888,882 S1571A probably damaging Het
Agbl1 C A 7: 76,698,765 A870D unknown Het
Alpl C T 4: 137,743,809 G339R probably damaging Het
Ankrd55 T C 13: 112,367,964 Y415H probably damaging Het
Cd69 G A 6: 129,270,045 R111C possibly damaging Het
Cdh26 A T 2: 178,460,103 T172S probably damaging Het
Cflar T A 1: 58,752,807 V423E Het
Cgrrf1 A C 14: 46,853,958 Q313P possibly damaging Het
Chga G A 12: 102,561,347 A87T probably benign Het
Chrna4 T A 2: 181,018,593 D102V Het
Cpvl A T 6: 53,932,517 Y211* probably null Het
Cyp26a1 G A 19: 37,701,064 D403N possibly damaging Het
Dchs2 T C 3: 83,129,482 L512P probably damaging Het
Dll3 A C 7: 28,301,745 M1R probably null Het
Dnah12 A G 14: 26,781,380 T1564A probably damaging Het
Efhb A G 17: 53,400,808 S776P probably damaging Het
Eml5 T C 12: 98,792,563 S1831G probably damaging Het
Fat1 G T 8: 44,988,930 probably null Het
Fhad1 T C 4: 141,905,064 K1255E probably benign Het
Fitm2 C T 2: 163,469,972 C107Y probably damaging Het
Gdpd4 T C 7: 97,971,939 V153A probably benign Het
Ggnbp2 A G 11: 84,860,713 V87A possibly damaging Het
Glb1l G T 1: 75,201,792 A334E probably damaging Het
Gnas T G 2: 174,300,212 L784R probably damaging Het
Gtf2i C T 5: 134,282,805 E223K probably damaging Het
H2-M10.5 T C 17: 36,773,749 Y122H probably damaging Het
Hikeshi G A 7: 89,930,346 Q6* probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Irak2 A C 6: 113,690,898 D528A probably damaging Het
Lcn2 A G 2: 32,388,030 C17R unknown Het
Lcp2 G T 11: 34,050,924 V36L probably benign Het
Lin7c T C 2: 109,896,272 S89P probably benign Het
Lrrc37a C T 11: 103,504,378 A74T probably benign Het
Lrrtm3 T A 10: 64,088,039 M450L probably benign Het
Lsm11 C T 11: 45,933,941 R253Q probably benign Het
Map9 A T 3: 82,358,983 probably benign Het
Mmp2 T A 8: 92,831,730 D142E possibly damaging Het
Nrn1l A T 8: 105,894,798 T127S probably damaging Het
Pelp1 G A 11: 70,394,759 T761I probably damaging Het
Pmm2 T A 16: 8,645,390 V63E probably damaging Het
Ptprb T A 10: 116,372,948 L1942H probably damaging Het
Ptprk T A 10: 28,589,370 C1350S possibly damaging Het
Rnf44 A G 13: 54,682,028 V381A probably damaging Het
Robo3 G A 9: 37,418,520 P1167S probably benign Het
Ryk A G 9: 102,898,780 E489G probably damaging Het
Satb2 T A 1: 56,871,524 I321L probably benign Het
Sh2b1 A T 7: 126,467,757 V655E probably benign Het
Slc16a12 G A 19: 34,670,635 T486M probably damaging Het
Slc34a1 G T 13: 55,413,408 R562L probably benign Het
Slc4a9 A G 18: 36,536,849 E779G probably damaging Het
Strc C A 2: 121,377,096 C598F probably damaging Het
Stxbp6 A T 12: 44,902,027 F100I probably damaging Het
Tap2 A G 17: 34,205,697 T135A probably benign Het
Tmcc1 G A 6: 116,133,844 P159S Het
Tmem106b T A 6: 13,078,106 M100K probably benign Het
Ttn T A 2: 76,747,695 T24285S probably damaging Het
Vmn1r116 G A 7: 20,872,412 V53M possibly damaging Het
Zar1 A T 5: 72,580,850 S70T probably benign Het
Zfp235 C T 7: 24,142,100 T648M probably benign Het
Zfp937 C T 2: 150,239,348 H433Y probably damaging Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R2379:Olfr310 UTSW 7 86269649 missense probably damaging 1.00
R3692:Olfr310 UTSW 7 86269495 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4291:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4295:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6207:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R6493:Olfr310 UTSW 7 86268882 missense probably benign 0.21
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7196:Olfr310 UTSW 7 86269441 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Z1176:Olfr310 UTSW 7 86268947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGAGGAAGAAGTACATGG -3'
(R):5'- ATACCATACAACTGGACAGATAGG -3'

Sequencing Primer
(F):5'- AGAAGTACATGGGTGTGTTCAG -3'
(R):5'- ATTAAGTTATTCCTTGTCC -3'
Posted On2019-11-12