Mutagenetix > Incidental Mutation

Incidental Mutation 'R7695:Scn2a'

593584

Institutional Source

Beutler Lab

Gene Symbol

Scn2a

Ensembl Gene

ENSMUSG00000075318

Gene Name

sodium channel, voltage-gated, type II, alpha

Synonyms

A230052E19Rik, Scn2a1, Nav1.2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7695 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65620771-65767447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65711907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 785 (T785A)

Ref Sequence

ENSEMBL: ENSMUSP00000028377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]

AlphaFold

B1AWN6

Predicted Effect

probably damaging
Transcript: ENSMUST00000028377
AA Change: T785A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: T785A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	2.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	9.6e-83	PFAM
Pfam:Ion_trans	759	994	3.6e-57	PFAM
Pfam:Na_trans_assoc	998	1204	1.7e-63	PFAM
Pfam:Ion_trans	1208	1484	3.3e-66	PFAM
Pfam:Ion_trans	1531	1788	2.8e-57	PFAM
Pfam:PKD_channel	1627	1782	8.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100067
AA Change: T785A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: T785A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	157	424	3.3e-75	PFAM
low complexity region	433	448	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
Pfam:DUF3451	488	711	2.6e-66	PFAM
Pfam:Ion_trans	794	983	1.1e-47	PFAM
Pfam:Na_trans_assoc	998	1219	3.5e-77	PFAM
Pfam:Ion_trans	1245	1473	4.4e-55	PFAM
PDB:1BYY\|A	1475	1527	3e-31	PDB
Pfam:Ion_trans	1566	1776	2.4e-52	PFAM
Pfam:PKD_channel	1628	1783	3.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200829
AA Change: T785A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: T785A

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	1.2e-79	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	7.1e-80	PFAM
Pfam:Ion_trans	759	994	2.1e-55	PFAM
Pfam:Na_trans_assoc	998	1204	8e-61	PFAM
Pfam:Ion_trans	1208	1484	1.9e-64	PFAM
Pfam:Ion_trans	1531	1788	1.6e-55	PFAM
Pfam:PKD_channel	1627	1782	1.2e-4	PFAM
IQ	1905	1927	1.8e-5	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	T	C	13: 98,984,258	T87A	probably damaging	Het
Adgrb1	T	C	15: 74,543,638	V689A	possibly damaging	Het
Casp12	A	G	9: 5,353,641	E225G	probably damaging	Het
Ccdc39	A	G	3: 33,814,519	L806P	probably damaging	Het
Ccnd3	T	A	17: 47,597,496	I164N	probably damaging	Het
Cd209b	A	G	8: 3,926,005	V52A	probably benign	Het
Celsr2	G	A	3: 108,402,753	R1554W	probably damaging	Het
Cnot1	A	T	8: 95,770,632	I239N	probably benign	Het
Csmd3	A	T	15: 47,820,381	V948D		Het
Dnmt1	C	A	9: 20,913,985	G1061V	probably null	Het
Dpysl4	A	G	7: 139,086,123	M1V	probably null	Het
Elp5	T	C	11: 69,969,501	T227A	probably benign	Het
Exosc1	G	A	19: 41,928,080	H86Y	possibly damaging	Het
Foxn4	G	T	5: 114,256,587	D426E	probably damaging	Het
Gabbr2	A	G	4: 46,875,687	L145P	probably damaging	Het
Gkn3	A	G	6: 87,384,440	Y126H	probably damaging	Het
Gm16506	A	G	14: 43,725,006	F148S		Het
Gm3558	A	G	14: 7,551,798	I76T	probably benign	Het
Gm49359	A	G	13: 62,456,744	F45S	possibly damaging	Het
Gpc5	A	T	14: 115,092,594	H63L	unknown	Het
Hbs1l	A	T	10: 21,299,217	D28V	possibly damaging	Het
Ide	G	A	19: 37,329,036	H113Y		Het
Igkv3-3	A	T	6: 70,687,311	S46C	probably damaging	Het
Igsf10	A	T	3: 59,326,191	V1707D	probably damaging	Het
Kcna5	A	T	6: 126,534,211	V318E	probably damaging	Het
Kdm3b	T	C	18: 34,794,559	F158S	possibly damaging	Het
Lrrc14b	T	A	13: 74,363,178	D261V	possibly damaging	Het
Lrrc71	T	A	3: 87,739,462	I485F	probably damaging	Het
Map6	C	T	7: 99,336,292	L671F	possibly damaging	Het
Mast1	A	G	8: 84,920,928	V560A	probably damaging	Het
Mfap4	A	T	11: 61,485,719		probably null	Het
Myh9	A	G	15: 77,766,736	I1637T	probably benign	Het
Neo1	A	T	9: 58,902,929	F1080I	possibly damaging	Het
Olfr1269	A	G	2: 90,118,863	V245A	probably benign	Het
Olfr1298	A	G	2: 111,645,625	V124A	probably damaging	Het
Olfr23	T	A	11: 73,940,894	V216E	possibly damaging	Het
Olfr559	T	C	7: 102,723,659	H277R	probably benign	Het
Pax2	A	G	19: 44,833,199	Y318C	probably damaging	Het
Pcnx4	A	T	12: 72,541,576	M53L	probably benign	Het
Pkd2l2	T	A	18: 34,428,245	D435E	possibly damaging	Het
Plec	G	A	15: 76,183,855	Q1117*	probably null	Het
Ppp2r2c	T	C	5: 36,947,182	L302P	probably damaging	Het
Prex2	T	C	1: 11,162,273	F855L	probably benign	Het
Reg3d	A	T	6: 78,377,136	W103R	probably benign	Het
Rnf216	A	C	5: 143,085,904	H440Q	possibly damaging	Het
Sh3pxd2a	T	A	19: 47,267,831	Y844F	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Spp1	T	C	5: 104,435,143		probably benign	Het
Tacc2	T	A	7: 130,728,903	S196T	probably benign	Het
Thrap3	G	A	4: 126,180,098	S285L	probably damaging	Het
Ttn	T	A	2: 76,835,961	R11584*	probably null	Het
Ubap2	A	G	4: 41,211,740	S341P	probably damaging	Het
Upf3a	T	G	8: 13,798,279	S358R	probably benign	Het
Zdbf2	T	A	1: 63,307,370	I1636N	possibly damaging	Het
Zfp946	C	A	17: 22,455,021	T252N	probably benign	Het

Other mutations in Scn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn2a	APN	2	65764440	missense	probably benign
IGL00159:Scn2a	APN	2	65743090	missense	probably damaging	1.00
IGL00418:Scn2a	APN	2	65764522	missense	probably benign	0.43
IGL00753:Scn2a	APN	2	65683863	missense	possibly damaging	0.66
IGL00770:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00774:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00847:Scn2a	APN	2	65670734	missense	probably damaging	1.00
IGL01155:Scn2a	APN	2	65717748	missense	probably damaging	1.00
IGL01329:Scn2a	APN	2	65717508	missense	probably benign	0.05
IGL01537:Scn2a	APN	2	65715875	missense	probably benign	0.00
IGL01672:Scn2a	APN	2	65751934	missense	probably damaging	1.00
IGL01958:Scn2a	APN	2	65701829	missense	probably damaging	1.00
IGL02028:Scn2a	APN	2	65763658	missense	probably damaging	0.96
IGL02142:Scn2a	APN	2	65715838	missense	probably damaging	1.00
IGL02160:Scn2a	APN	2	65730116	missense	probably damaging	1.00
IGL02183:Scn2a	APN	2	65671603	missense	probably benign	0.20
IGL02341:Scn2a	APN	2	65688377	missense	probably damaging	1.00
IGL02504:Scn2a	APN	2	65683884	missense	probably benign	0.02
IGL02530:Scn2a	APN	2	65730178	missense	probably damaging	0.99
IGL02621:Scn2a	APN	2	65748879	splice site	probably benign
IGL02652:Scn2a	APN	2	65702038	missense	possibly damaging	0.82
IGL02966:Scn2a	APN	2	65701844	missense	possibly damaging	0.93
IGL03188:Scn2a	APN	2	65671653	missense	probably damaging	0.99
IGL03329:Scn2a	APN	2	65764629	missense	probably benign
IGL03336:Scn2a	APN	2	65688744	missense	probably damaging	1.00
IGL03391:Scn2a	APN	2	65764213	missense	probably damaging	1.00
PIT4280001:Scn2a	UTSW	2	65715730	missense	probably damaging	1.00
PIT4362001:Scn2a	UTSW	2	65683838	missense	probably benign	0.09
PIT4403001:Scn2a	UTSW	2	65711908	missense	probably damaging	1.00
PIT4520001:Scn2a	UTSW	2	65688419	missense	probably damaging	1.00
R0021:Scn2a	UTSW	2	65670515	missense	possibly damaging	0.51
R0141:Scn2a	UTSW	2	65711816	missense	probably benign	0.01
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0335:Scn2a	UTSW	2	65682091	missense	probably damaging	1.00
R0508:Scn2a	UTSW	2	65717842	missense	probably damaging	0.99
R0558:Scn2a	UTSW	2	65711925	missense	probably benign	0.26
R0600:Scn2a	UTSW	2	65701833	missense	possibly damaging	0.90
R0667:Scn2a	UTSW	2	65751996	missense	possibly damaging	0.91
R1178:Scn2a	UTSW	2	65686779	splice site	probably benign
R1244:Scn2a	UTSW	2	65763655	missense	probably damaging	0.98
R1386:Scn2a	UTSW	2	65688741	missense	probably damaging	1.00
R1434:Scn2a	UTSW	2	65701991	missense	possibly damaging	0.79
R1440:Scn2a	UTSW	2	65764594	missense	probably benign
R1448:Scn2a	UTSW	2	65683845	missense	probably benign	0.17
R1460:Scn2a	UTSW	2	65701843	missense	probably damaging	0.96
R1553:Scn2a	UTSW	2	65713836	nonsense	probably null
R1642:Scn2a	UTSW	2	65683697	missense	probably damaging	1.00
R1803:Scn2a	UTSW	2	65670767	splice site	probably null
R1981:Scn2a	UTSW	2	65690170	missense	probably damaging	1.00
R2002:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R2068:Scn2a	UTSW	2	65752073	missense	probably benign	0.14
R2125:Scn2a	UTSW	2	65752079	nonsense	probably null
R2126:Scn2a	UTSW	2	65752079	nonsense	probably null
R2876:Scn2a	UTSW	2	65715897	missense	possibly damaging	0.64
R2878:Scn2a	UTSW	2	65688371	missense	probably damaging	1.00
R3113:Scn2a	UTSW	2	65748785	missense	possibly damaging	0.86
R3749:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3750:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3765:Scn2a	UTSW	2	65682710	missense	possibly damaging	0.51
R3850:Scn2a	UTSW	2	65682031	missense	probably benign	0.14
R4585:Scn2a	UTSW	2	65743051	splice site	probably null
R4586:Scn2a	UTSW	2	65743051	splice site	probably null
R4588:Scn2a	UTSW	2	65713767	missense	possibly damaging	0.76
R4622:Scn2a	UTSW	2	65752027	missense	probably benign	0.04
R5108:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R5161:Scn2a	UTSW	2	65764591	missense	probably benign	0.00
R5235:Scn2a	UTSW	2	65752011	missense	probably damaging	1.00
R5464:Scn2a	UTSW	2	65701756	missense	probably damaging	1.00
R5586:Scn2a	UTSW	2	65707295	nonsense	probably null
R5630:Scn2a	UTSW	2	65726365	missense	probably damaging	1.00
R5715:Scn2a	UTSW	2	65717584	missense	probably benign	0.27
R5730:Scn2a	UTSW	2	65682538	nonsense	probably null
R5734:Scn2a	UTSW	2	65717722	missense	possibly damaging	0.49
R5779:Scn2a	UTSW	2	65764483	missense	probably benign	0.00
R6133:Scn2a	UTSW	2	65743104	missense	probably benign	0.35
R6547:Scn2a	UTSW	2	65715897	missense	probably benign	0.29
R6549:Scn2a	UTSW	2	65764674	missense	probably benign	0.05
R6818:Scn2a	UTSW	2	65688669	nonsense	probably null
R6999:Scn2a	UTSW	2	65682109	missense	probably benign
R7069:Scn2a	UTSW	2	65764606	missense	probably benign	0.00
R7073:Scn2a	UTSW	2	65728443	missense	probably benign	0.00
R7125:Scn2a	UTSW	2	65763933	missense	probably damaging	1.00
R7178:Scn2a	UTSW	2	65748853	nonsense	probably null
R7179:Scn2a	UTSW	2	65701979	missense	probably damaging	1.00
R7203:Scn2a	UTSW	2	65748319	missense	probably benign	0.01
R7227:Scn2a	UTSW	2	65752023	missense	probably damaging	0.98
R7269:Scn2a	UTSW	2	65763769	missense	probably damaging	1.00
R7358:Scn2a	UTSW	2	65682506	nonsense	probably null
R7388:Scn2a	UTSW	2	65688654	missense	probably damaging	1.00
R7491:Scn2a	UTSW	2	65702008	missense	probably damaging	0.99
R7619:Scn2a	UTSW	2	65715903	missense	probably damaging	1.00
R7735:Scn2a	UTSW	2	65763669	missense	probably benign	0.40
R7911:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R8096:Scn2a	UTSW	2	65764022	missense	probably damaging	0.98
R8172:Scn2a	UTSW	2	65690328	missense	probably benign	0.01
R8220:Scn2a	UTSW	2	65690276	missense	probably benign	0.01
R8333:Scn2a	UTSW	2	65683847	missense	probably benign	0.01
R8416:Scn2a	UTSW	2	65681001	missense	probably benign	0.00
R8850:Scn2a	UTSW	2	65688386	missense	probably damaging	1.00
R8897:Scn2a	UTSW	2	65715658	critical splice acceptor site	probably null
R8977:Scn2a	UTSW	2	65763670	missense	probably damaging	0.99
R8992:Scn2a	UTSW	2	65763898	missense	probably damaging	1.00
R9190:Scn2a	UTSW	2	65681002	missense	probably benign	0.00
R9206:Scn2a	UTSW	2	65717787	missense	probably damaging	1.00
R9355:Scn2a	UTSW	2	65764089	missense	probably damaging	1.00
R9452:Scn2a	UTSW	2	65764819	missense	probably benign
R9529:Scn2a	UTSW	2	65764588	missense	probably damaging	0.99
R9567:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R9569:Scn2a	UTSW	2	65730278	missense	probably damaging	1.00
R9657:Scn2a	UTSW	2	65735688	missense	probably damaging	1.00
R9715:Scn2a	UTSW	2	65748805	missense	possibly damaging	0.93
R9761:Scn2a	UTSW	2	65735686	missense	probably damaging	1.00
Z1176:Scn2a	UTSW	2	65751868	missense	possibly damaging	0.84
Z1177:Scn2a	UTSW	2	65717735	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGAAATGCCCTCCATGCTG -3'
(R):5'- AACCTCTGAATCCTTTGTACTGAG -3'

Sequencing Primer
(F):5'- ATGCCCTCCATGCTGGTATAAATTTG -3'
(R):5'- TGTACTGAGTTCAAGTAGGAACCTG -3'

Posted On

2019-11-12