Incidental Mutation 'R7695:Ubap2'
ID593592
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41211740 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 341 (S341P)
Ref Sequence ENSEMBL: ENSMUSP00000030143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068] [ENSMUST00000135323]
Predicted Effect probably damaging
Transcript: ENSMUST00000030143
AA Change: S341P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: S341P

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108068
AA Change: S340P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: S340P

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135323
AA Change: S74P

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122256
Gene: ENSMUSG00000028433
AA Change: S74P

DomainStartEndE-ValueType
low complexity region 74 91 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 unclassified probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 unclassified probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
R7811:Ubap2 UTSW 4 41211710 missense probably benign 0.22
R7828:Ubap2 UTSW 4 41221615 missense probably benign 0.00
R7838:Ubap2 UTSW 4 41233655 missense probably damaging 1.00
R8016:Ubap2 UTSW 4 41195201 missense possibly damaging 0.91
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTACATCACTGTTTCCTGGGTG -3'
(R):5'- TCCATTTGACTGGCTGGTGC -3'

Sequencing Primer
(F):5'- TTCCTGGGTGAAGATCCACTGAC -3'
(R):5'- GTGCAACTTGCTCATGACAG -3'
Posted On2019-11-12