Incidental Mutation 'R7695:Gabbr2'
ID593593
Institutional Source Beutler Lab
Gene Symbol Gabbr2
Ensembl Gene ENSMUSG00000039809
Gene Namegamma-aminobutyric acid (GABA) B receptor, 2
SynonymsGpr51, Gababr2, LOC242425
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46662305-46991873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46875687 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 145 (L145P)
Ref Sequence ENSEMBL: ENSMUSP00000103378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107749]
Predicted Effect probably damaging
Transcript: ENSMUST00000107749
AA Change: L145P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: L145P

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peripla_BP_6 59 434 1.5e-15 PFAM
Pfam:ANF_receptor 75 429 2e-51 PFAM
Pfam:7tm_3 492 745 6.4e-57 PFAM
PDB:4PAS|B 778 818 1e-18 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Gabbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Gabbr2 APN 4 46787600 missense probably damaging 1.00
IGL00844:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL01584:Gabbr2 APN 4 46674524 missense probably damaging 0.97
IGL01684:Gabbr2 APN 4 46736501 missense probably benign
IGL01884:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL02073:Gabbr2 APN 4 46667547 missense probably benign 0.00
IGL02376:Gabbr2 APN 4 46684300 missense probably damaging 1.00
R0194:Gabbr2 UTSW 4 46787565 missense possibly damaging 0.48
R0627:Gabbr2 UTSW 4 46681223 missense possibly damaging 0.92
R0685:Gabbr2 UTSW 4 46787521 missense possibly damaging 0.64
R0781:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R0882:Gabbr2 UTSW 4 46718904 missense probably damaging 1.00
R0883:Gabbr2 UTSW 4 46677474 missense probably benign 0.00
R1004:Gabbr2 UTSW 4 46677544 missense possibly damaging 0.60
R1078:Gabbr2 UTSW 4 46664833 missense probably damaging 0.99
R1110:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R1368:Gabbr2 UTSW 4 46674464 missense probably benign 0.31
R1557:Gabbr2 UTSW 4 46846436 missense probably damaging 1.00
R1577:Gabbr2 UTSW 4 46684319 missense probably benign 0.29
R1645:Gabbr2 UTSW 4 46664963 splice site probably null
R1743:Gabbr2 UTSW 4 46677603 missense possibly damaging 0.47
R1848:Gabbr2 UTSW 4 46739823 missense probably benign 0.31
R1997:Gabbr2 UTSW 4 46787502 missense probably damaging 1.00
R2009:Gabbr2 UTSW 4 46734119 missense probably damaging 1.00
R4021:Gabbr2 UTSW 4 46846435 missense probably damaging 1.00
R4719:Gabbr2 UTSW 4 46718797 missense probably damaging 0.99
R4757:Gabbr2 UTSW 4 46875675 missense probably damaging 0.98
R4798:Gabbr2 UTSW 4 46991139 missense possibly damaging 0.92
R5086:Gabbr2 UTSW 4 46724342 missense probably damaging 1.00
R5176:Gabbr2 UTSW 4 46681208 missense probably damaging 0.99
R5451:Gabbr2 UTSW 4 46684294 missense probably benign 0.15
R5510:Gabbr2 UTSW 4 46734113 missense probably damaging 1.00
R5611:Gabbr2 UTSW 4 46804105 missense probably damaging 0.98
R6049:Gabbr2 UTSW 4 46787641 missense probably damaging 1.00
R6089:Gabbr2 UTSW 4 46846448 missense probably damaging 1.00
R6118:Gabbr2 UTSW 4 46736459 missense probably damaging 1.00
R6209:Gabbr2 UTSW 4 46804069 missense probably damaging 1.00
R6212:Gabbr2 UTSW 4 46681189 missense probably damaging 0.98
R6717:Gabbr2 UTSW 4 46787574 missense possibly damaging 0.50
R7339:Gabbr2 UTSW 4 46846340 missense probably benign 0.01
R7479:Gabbr2 UTSW 4 46681166 missense probably damaging 0.98
R7808:Gabbr2 UTSW 4 46875744 missense possibly damaging 0.49
R7832:Gabbr2 UTSW 4 46734096 missense probably benign 0.04
R7915:Gabbr2 UTSW 4 46734096 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTAGGGAGTCAGCAGTGAACAC -3'
(R):5'- TTGCCCCAGGATAACCCATG -3'

Sequencing Primer
(F):5'- CACGAACAGTTAAAGGACTCTTGGTC -3'
(R):5'- GGATAACCCATGTCTAACTTAGGC -3'
Posted On2019-11-12