Incidental Mutation 'R7695:Ppp2r2c'
ID593595
Institutional Source Beutler Lab
Gene Symbol Ppp2r2c
Ensembl Gene ENSMUSG00000029120
Gene Nameprotein phosphatase 2, regulatory subunit B, gamma
Synonyms6330548O06Rik, IMYPNO1, PR52
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36868513-36955078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36947182 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 302 (L302P)
Ref Sequence ENSEMBL: ENSMUSP00000031003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031003]
Predicted Effect probably damaging
Transcript: ENSMUST00000031003
AA Change: L302P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031003
Gene: ENSMUSG00000029120
AA Change: L302P

DomainStartEndE-ValueType
WD40 13 52 1.99e0 SMART
WD40 79 119 2.38e1 SMART
WD40 161 200 1.11e0 SMART
WD40 211 251 5.7e1 SMART
WD40 270 308 4.11e1 SMART
Blast:WD40 312 366 1e-24 BLAST
WD40 402 439 3.07e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Ppp2r2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Ppp2r2c APN 5 36947121 missense possibly damaging 0.82
IGL01583:Ppp2r2c APN 5 36868822 start codon destroyed probably null 0.99
IGL01662:Ppp2r2c APN 5 36926400 missense probably damaging 1.00
IGL01674:Ppp2r2c APN 5 36940226 missense possibly damaging 0.63
IGL02027:Ppp2r2c APN 5 36952472 missense probably damaging 0.99
IGL03118:Ppp2r2c APN 5 36926316 missense probably damaging 1.00
R0034:Ppp2r2c UTSW 5 36927539 missense probably benign 0.02
R2036:Ppp2r2c UTSW 5 36952404 missense possibly damaging 0.84
R4877:Ppp2r2c UTSW 5 36868870 missense probably damaging 0.98
R4980:Ppp2r2c UTSW 5 36952388 missense probably benign 0.01
R5838:Ppp2r2c UTSW 5 36940187 missense probably benign 0.14
R6291:Ppp2r2c UTSW 5 36940124 missense possibly damaging 0.95
R6940:Ppp2r2c UTSW 5 36927531 missense probably damaging 0.98
R7405:Ppp2r2c UTSW 5 36947142 missense possibly damaging 0.71
R7967:Ppp2r2c UTSW 5 36940106 missense possibly damaging 0.88
R8307:Ppp2r2c UTSW 5 36947086 missense probably damaging 1.00
X0013:Ppp2r2c UTSW 5 36926325 missense probably damaging 1.00
Z1176:Ppp2r2c UTSW 5 36931277 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACAGATGAATACAGCCAGCTCTG -3'
(R):5'- CAAAGGCTCTCTGCAGTTTCATC -3'

Sequencing Primer
(F):5'- CCAGCTCTGGTTCTGACTGG -3'
(R):5'- GCAGTTTCATCTACACTGCAAC -3'
Posted On2019-11-12