Incidental Mutation 'R7695:Foxn4'
ID593597
Institutional Source Beutler Lab
Gene Symbol Foxn4
Ensembl Gene ENSMUSG00000042002
Gene Nameforkhead box N4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114254164-114273807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114256587 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 426 (D426E)
Ref Sequence ENSEMBL: ENSMUSP00000047951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044790] [ENSMUST00000129530] [ENSMUST00000144050]
Predicted Effect probably damaging
Transcript: ENSMUST00000044790
AA Change: D426E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047951
Gene: ENSMUSG00000042002
AA Change: D426E

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
FH 195 287 2.15e-46 SMART
low complexity region 386 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129530
Predicted Effect probably benign
Transcript: ENSMUST00000144050
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the winged-helix/forkhead family of transcription factors, such as FOXN4, are characterized by a 110-amino acid DNA-binding domain that can fold into a variant of the helix-turn-helix motif consisting of 3 alpha helices flanked by 2 large loops or wings. These transcription factors are involved in a variety of biologic processes as key regulators in development and metabolism (Li et al., 2004 [PubMed 15363391]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and abnormal retina morphology with a total loss of horizontal cells and decreased amacrine cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Foxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02990:Foxn4 APN 5 114272989 missense probably damaging 0.98
R0001:Foxn4 UTSW 5 114260870 missense probably damaging 1.00
R0194:Foxn4 UTSW 5 114259748 critical splice donor site probably null
R0555:Foxn4 UTSW 5 114263114 missense probably damaging 1.00
R0617:Foxn4 UTSW 5 114261068 splice site probably benign
R1662:Foxn4 UTSW 5 114256894 missense probably benign
R1785:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R1786:Foxn4 UTSW 5 114263132 missense probably damaging 0.99
R2266:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2267:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2268:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2269:Foxn4 UTSW 5 114255601 missense probably damaging 0.99
R2397:Foxn4 UTSW 5 114255495 missense probably damaging 1.00
R3121:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R3122:Foxn4 UTSW 5 114258715 missense probably damaging 0.99
R4579:Foxn4 UTSW 5 114256825 missense possibly damaging 0.65
R4623:Foxn4 UTSW 5 114260930 missense possibly damaging 0.64
R4749:Foxn4 UTSW 5 114255567 missense probably damaging 1.00
R5083:Foxn4 UTSW 5 114256927 missense probably damaging 1.00
R5100:Foxn4 UTSW 5 114256759 missense possibly damaging 0.87
R5661:Foxn4 UTSW 5 114272992 missense probably benign
R7015:Foxn4 UTSW 5 114256855 missense possibly damaging 0.95
R7292:Foxn4 UTSW 5 114258655 nonsense probably null
R7342:Foxn4 UTSW 5 114258699 missense probably damaging 1.00
R7627:Foxn4 UTSW 5 114260434 missense possibly damaging 0.87
R7970:Foxn4 UTSW 5 114263007 critical splice donor site probably null
R8037:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
R8038:Foxn4 UTSW 5 114256597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGTAACCCCACCTGAC -3'
(R):5'- AAGCCACTGATGACCCTGTC -3'

Sequencing Primer
(F):5'- ACCTGACTTAGCGTGTGTAAC -3'
(R):5'- TGATGACCCTGTCCCTGCAG -3'
Posted On2019-11-12