Incidental Mutation 'R7695:Map6'
ID 593603
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 045758-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R7695 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98985499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 671 (L671F)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000068973
AA Change: L671F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: L671F

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000207883
AA Change: L671F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect possibly damaging
Transcript: ENSMUST00000208924
AA Change: L468F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,415,487 (GRCm39) V689A possibly damaging Het
Casp12 A G 9: 5,353,641 (GRCm39) E225G probably damaging Het
Ccdc39 A G 3: 33,868,668 (GRCm39) L806P probably damaging Het
Ccnd3 T A 17: 47,908,421 (GRCm39) I164N probably damaging Het
Cd209b A G 8: 3,976,005 (GRCm39) V52A probably benign Het
Celsr2 G A 3: 108,310,069 (GRCm39) R1554W probably damaging Het
Cnot1 A T 8: 96,497,260 (GRCm39) I239N probably benign Het
Csmd3 A T 15: 47,683,777 (GRCm39) V948D Het
Dnmt1 C A 9: 20,825,281 (GRCm39) G1061V probably null Het
Dpysl4 A G 7: 138,666,039 (GRCm39) M1V probably null Het
Elp5 T C 11: 69,860,327 (GRCm39) T227A probably benign Het
Exosc1 G A 19: 41,916,519 (GRCm39) H86Y possibly damaging Het
Foxn4 G T 5: 114,394,648 (GRCm39) D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 (GRCm39) L145P probably damaging Het
Gkn3 A G 6: 87,361,422 (GRCm39) Y126H probably damaging Het
Gm16506 A G 14: 43,962,463 (GRCm39) F148S Het
Gm3558 A G 14: 19,121,623 (GRCm39) I76T probably benign Het
Gm49359 A G 13: 62,604,558 (GRCm39) F45S possibly damaging Het
Gpc5 A T 14: 115,330,026 (GRCm39) H63L unknown Het
H2bl1 T C 13: 99,120,766 (GRCm39) T87A probably damaging Het
Hbs1l A T 10: 21,175,116 (GRCm39) D28V possibly damaging Het
Ide G A 19: 37,306,435 (GRCm39) H113Y Het
Igkv3-3 A T 6: 70,664,295 (GRCm39) S46C probably damaging Het
Igsf10 A T 3: 59,233,612 (GRCm39) V1707D probably damaging Het
Kcna5 A T 6: 126,511,174 (GRCm39) V318E probably damaging Het
Kdm3b T C 18: 34,927,612 (GRCm39) F158S possibly damaging Het
Lrrc14b T A 13: 74,511,297 (GRCm39) D261V possibly damaging Het
Lrrc71 T A 3: 87,646,769 (GRCm39) I485F probably damaging Het
Mast1 A G 8: 85,647,557 (GRCm39) V560A probably damaging Het
Mfap4 A T 11: 61,376,545 (GRCm39) probably null Het
Myh9 A G 15: 77,650,936 (GRCm39) I1637T probably benign Het
Neo1 A T 9: 58,810,212 (GRCm39) F1080I possibly damaging Het
Or1e17 T A 11: 73,831,720 (GRCm39) V216E possibly damaging Het
Or4k48 A G 2: 111,475,970 (GRCm39) V124A probably damaging Het
Or4x6 A G 2: 89,949,207 (GRCm39) V245A probably benign Het
Or51a25 T C 7: 102,372,866 (GRCm39) H277R probably benign Het
Pax2 A G 19: 44,821,638 (GRCm39) Y318C probably damaging Het
Pcnx4 A T 12: 72,588,350 (GRCm39) M53L probably benign Het
Pkd2l2 T A 18: 34,561,298 (GRCm39) D435E possibly damaging Het
Plec G A 15: 76,068,055 (GRCm39) Q1117* probably null Het
Ppp2r2c T C 5: 37,104,526 (GRCm39) L302P probably damaging Het
Prex2 T C 1: 11,232,497 (GRCm39) F855L probably benign Het
Reg3d A T 6: 78,354,119 (GRCm39) W103R probably benign Het
Rnf216 A C 5: 143,071,659 (GRCm39) H440Q possibly damaging Het
Scn2a A G 2: 65,542,251 (GRCm39) T785A probably damaging Het
Sh3pxd2a T A 19: 47,256,270 (GRCm39) Y844F probably damaging Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spp1 T C 5: 104,583,009 (GRCm39) probably benign Het
Tacc2 T A 7: 130,330,633 (GRCm39) S196T probably benign Het
Thrap3 G A 4: 126,073,891 (GRCm39) S285L probably damaging Het
Ttn T A 2: 76,666,305 (GRCm39) R11584* probably null Het
Ubap2 A G 4: 41,211,740 (GRCm39) S341P probably damaging Het
Upf3a T G 8: 13,848,279 (GRCm39) S358R probably benign Het
Zdbf2 T A 1: 63,346,529 (GRCm39) I1636N possibly damaging Het
Zfp946 C A 17: 22,674,002 (GRCm39) T252N probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGACTGCCAAAAGATC -3'
(R):5'- TTCTTCAAAGAGGCCATGATGG -3'

Sequencing Primer
(F):5'- AGATCAAGTTCCTGTAGTCCCAG -3'
(R):5'- GGAGACATGCTGGTCCTTCCTAC -3'
Posted On 2019-11-12