Incidental Mutation 'R7695:Cd209b'
ID593607
Institutional Source Beutler Lab
Gene Symbol Cd209b
Ensembl Gene ENSMUSG00000065987
Gene NameCD209b antigen
Synonyms1810030I22Rik, SIGNR1, mSIGNR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3917655-3926844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3926005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 52 (V52A)
Ref Sequence ENSEMBL: ENSMUSP00000081104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084086] [ENSMUST00000111014] [ENSMUST00000171635] [ENSMUST00000188386]
PDB Structure
Crystallographic structure of the native mouse SIGN-R1 CRD domain [X-RAY DIFFRACTION]
Structure of SIGN-R1 in complex with Sulfodextran [X-RAY DIFFRACTION]
Crystallographic structure of the mouse SIGN-R1 CRD domain in complex with sialic acid [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000084086
AA Change: V52A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081104
Gene: ENSMUSG00000065987
AA Change: V52A

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
CLECT 195 316 3.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111014
AA Change: V52A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106643
Gene: ENSMUSG00000065987
AA Change: V52A

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171635
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188386
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are more susceptible to S. pneumoniae infection and fail to clear the bacteria from the circulation. Marginal zone and peritoneal macrophages are impaired in recognizing the bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Cd209b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cd209b APN 8 3919945 splice site probably benign
IGL01596:Cd209b APN 8 3918744 missense probably damaging 1.00
IGL03211:Cd209b APN 8 3918830 splice site probably benign
R1434:Cd209b UTSW 8 3923367 missense possibly damaging 0.49
R4127:Cd209b UTSW 8 3918714 missense probably damaging 1.00
R4387:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4388:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4389:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4708:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4710:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4911:Cd209b UTSW 8 3926640 critical splice acceptor site probably null
R5454:Cd209b UTSW 8 3925396 missense probably damaging 0.98
R5814:Cd209b UTSW 8 3923348 missense probably damaging 0.99
R5853:Cd209b UTSW 8 3926549 splice site probably null
R5867:Cd209b UTSW 8 3924246 missense possibly damaging 0.62
R5996:Cd209b UTSW 8 3918688 missense probably benign 0.39
R7020:Cd209b UTSW 8 3918783 missense probably damaging 0.99
R7187:Cd209b UTSW 8 3926638 missense probably benign
R7712:Cd209b UTSW 8 3923299 missense possibly damaging 0.83
R7975:Cd209b UTSW 8 3925948 missense probably benign 0.41
R8309:Cd209b UTSW 8 3926559 nonsense probably null
R8317:Cd209b UTSW 8 3922018 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGATATGCCATCCACCTGC -3'
(R):5'- ACAGGGAATTGAGGGTCCTG -3'

Sequencing Primer
(F):5'- ATATGCCATCCACCTGCACTGTC -3'
(R):5'- TGATGCAAGGAATTAAGAGTCTTG -3'
Posted On2019-11-12