Incidental Mutation 'R7695:Casp12'
ID593611
Institutional Source Beutler Lab
Gene Symbol Casp12
Ensembl Gene ENSMUSG00000025887
Gene Namecaspase 12
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location5345430-5373032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5353641 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000027009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027009] [ENSMUST00000151332] [ENSMUST00000151788]
Predicted Effect probably damaging
Transcript: ENSMUST00000027009
AA Change: E225G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027009
Gene: ENSMUSG00000025887
AA Change: E225G

DomainStartEndE-ValueType
CARD 1 83 3.54e-2 SMART
CASc 165 417 2.59e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151332
AA Change: E155G

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122201
Gene: ENSMUSG00000025887
AA Change: E155G

DomainStartEndE-ValueType
CASc 95 347 2.59e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151788
AA Change: R229G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121565
Gene: ENSMUSG00000025887
AA Change: R229G

DomainStartEndE-ValueType
CARD 1 83 3.54e-2 SMART
Pfam:Peptidase_C14 176 230 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for some mutations of this gene display resistance to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Casp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Casp12 APN 9 5352665 splice site probably null
IGL00717:Casp12 APN 9 5352702 missense probably damaging 1.00
IGL02326:Casp12 APN 9 5358317 missense possibly damaging 0.92
R0016:Casp12 UTSW 9 5352844 missense probably null 0.01
R0016:Casp12 UTSW 9 5352844 missense probably null 0.01
R0329:Casp12 UTSW 9 5345534 splice site probably benign
R0392:Casp12 UTSW 9 5348973 splice site probably benign
R0584:Casp12 UTSW 9 5352268 missense probably null 0.00
R0609:Casp12 UTSW 9 5346554 missense probably damaging 1.00
R1099:Casp12 UTSW 9 5352204 missense probably benign
R1951:Casp12 UTSW 9 5348959 critical splice donor site probably null
R2034:Casp12 UTSW 9 5346491 missense probably damaging 0.97
R4208:Casp12 UTSW 9 5346629 missense probably damaging 1.00
R4558:Casp12 UTSW 9 5352742 missense probably damaging 1.00
R4592:Casp12 UTSW 9 5352923 intron probably benign
R4597:Casp12 UTSW 9 5348941 missense possibly damaging 0.55
R4913:Casp12 UTSW 9 5358726 missense probably damaging 1.00
R4965:Casp12 UTSW 9 5352250 missense probably benign 0.00
R5495:Casp12 UTSW 9 5353797 missense possibly damaging 0.95
R5777:Casp12 UTSW 9 5354548 missense probably benign 0.01
R6641:Casp12 UTSW 9 5354612 missense probably benign
R7159:Casp12 UTSW 9 5353763 missense possibly damaging 0.89
R7320:Casp12 UTSW 9 5348897 critical splice acceptor site probably null
R7349:Casp12 UTSW 9 5345527 critical splice donor site probably null
R7636:Casp12 UTSW 9 5358344 missense probably benign 0.15
R7819:Casp12 UTSW 9 5352805 missense probably damaging 1.00
R8071:Casp12 UTSW 9 5346647 missense probably damaging 1.00
Z1088:Casp12 UTSW 9 5354582 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAAGCAACCTGGGCAGATTTG -3'
(R):5'- CAGACTCCGACAGTTAGAGTTG -3'

Sequencing Primer
(F):5'- GCAACCTGGGCAGATTTGATTAAAC -3'
(R):5'- CACAGATTCCTTCCAGGATG -3'
Posted On2019-11-12