Incidental Mutation 'R7695:Olfr23'
ID593617
Institutional Source Beutler Lab
Gene Symbol Olfr23
Ensembl Gene ENSMUSG00000069816
Gene Nameolfactory receptor 23
SynonymsMTPCR50, MOR135-27, GA_x6K02T2P1NL-4097159-4098136
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73936677-73942658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73940894 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 216 (V216E)
Ref Sequence ENSEMBL: ENSMUSP00000150593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092917] [ENSMUST00000214210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092917
AA Change: V216E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090596
Gene: ENSMUSG00000069816
AA Change: V216E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-6 PFAM
Pfam:7tm_1 41 290 9.3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214210
AA Change: V216E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Olfr23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr23 APN 11 73941194 missense probably benign
IGL02290:Olfr23 APN 11 73940869 missense probably benign 0.00
IGL02301:Olfr23 APN 11 73941068 missense possibly damaging 0.79
IGL02303:Olfr23 APN 11 73940450 missense possibly damaging 0.87
IGL02510:Olfr23 APN 11 73941005 missense probably damaging 1.00
IGL02558:Olfr23 APN 11 73940825 missense probably benign 0.01
IGL02712:Olfr23 APN 11 73940930 missense probably benign 0.12
IGL02795:Olfr23 APN 11 73940929 missense probably benign 0.05
IGL02800:Olfr23 APN 11 73941116 missense probably damaging 1.00
IGL03350:Olfr23 APN 11 73940838 missense probably damaging 0.99
R0277:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0323:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0333:Olfr23 UTSW 11 73940767 missense possibly damaging 0.78
R0389:Olfr23 UTSW 11 73941053 missense probably benign 0.12
R0391:Olfr23 UTSW 11 73941109 missense probably damaging 1.00
R0723:Olfr23 UTSW 11 73940270 missense probably benign 0.00
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1900:Olfr23 UTSW 11 73940660 missense possibly damaging 0.79
R2363:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4236:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4630:Olfr23 UTSW 11 73940996 missense probably damaging 1.00
R4717:Olfr23 UTSW 11 73940815 missense possibly damaging 0.86
R4801:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4802:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4964:Olfr23 UTSW 11 73941202 missense probably benign 0.04
R5119:Olfr23 UTSW 11 73940552 missense possibly damaging 0.76
R5470:Olfr23 UTSW 11 73940870 missense probably benign 0.06
R6196:Olfr23 UTSW 11 73940809 missense possibly damaging 0.86
R6551:Olfr23 UTSW 11 73940303 missense probably benign 0.11
R8074:Olfr23 UTSW 11 73940387 missense possibly damaging 0.78
X0065:Olfr23 UTSW 11 73940324 missense possibly damaging 0.59
Z1088:Olfr23 UTSW 11 73941138 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGACAACATTGTGTGCCATG -3'
(R):5'- TGGGAGTCACCACAGTGTAC -3'

Sequencing Primer
(F):5'- TGCCATGTTGCACACTTTG -3'
(R):5'- GGAGTCACCACAGTGTACATCATAG -3'
Posted On2019-11-12