Incidental Mutation 'R0240:Lama3'
ID 59362
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Name laminin, alpha 3
Synonyms [a]3B, nicein, 150kDa
MMRRC Submission 038478-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0240 (G1)
Quality Score 224
Status Validated
Chromosome 18
Chromosomal Location 12466876-12716070 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 12672880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000092070
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188815
SMART Domains Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_Lam 78 122 2.66e-10 SMART
EGF_Lam 125 175 7.81e-8 SMART
Pfam:Laminin_I 230 496 1e-90 PFAM
low complexity region 579 594 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
LamG 800 960 1.67e-2 SMART
LamG 1008 1136 1.72e-17 SMART
LamG 1179 1294 3.96e-17 SMART
LamG 1399 1527 1.12e-34 SMART
LamG 1569 1702 3.41e-30 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 123,506,920 (GRCm39) L71P probably damaging Het
Adamts2 A T 11: 50,666,201 (GRCm39) D399V probably damaging Het
Adck2 T A 6: 39,560,752 (GRCm39) V380E probably benign Het
Alg11 T A 8: 22,555,468 (GRCm39) V243D possibly damaging Het
Ankrd27 T A 7: 35,318,864 (GRCm39) L585Q probably damaging Het
Armh4 A G 14: 50,005,859 (GRCm39) probably benign Het
Atp7a T A X: 105,153,447 (GRCm39) N1117K probably damaging Het
Bltp3a T A 17: 28,114,844 (GRCm39) probably benign Het
Cacna1b G A 2: 24,528,669 (GRCm39) probably benign Het
Cacna1d T A 14: 29,818,926 (GRCm39) M1210L probably benign Het
Cacna1s T C 1: 136,001,234 (GRCm39) probably benign Het
Chd7 T C 4: 8,852,670 (GRCm39) probably benign Het
Col12a1 A T 9: 79,559,315 (GRCm39) S1858T probably benign Het
Cotl1 C T 8: 120,567,063 (GRCm39) W26* probably null Het
Csmd3 T C 15: 47,492,635 (GRCm39) T3000A probably benign Het
Dcp1a T A 14: 30,206,551 (GRCm39) probably benign Het
Ddhd2 A T 8: 26,229,617 (GRCm39) probably null Het
Dnah8 T C 17: 30,984,653 (GRCm39) I3117T probably damaging Het
Dnm3 G T 1: 162,181,194 (GRCm39) Q162K probably benign Het
Dpy19l2 G T 9: 24,569,876 (GRCm39) A359D probably damaging Het
Ece1 T A 4: 137,676,746 (GRCm39) probably benign Het
Eif4g3 A G 4: 137,897,873 (GRCm39) K1025R probably damaging Het
Eml2 C A 7: 18,918,797 (GRCm39) Y82* probably null Het
Eml6 A G 11: 29,742,367 (GRCm39) V1057A possibly damaging Het
Eral1 A G 11: 77,966,884 (GRCm39) probably benign Het
Espl1 T C 15: 102,220,976 (GRCm39) S911P probably benign Het
Fbxo8 A G 8: 57,043,296 (GRCm39) probably benign Het
Flrt1 A T 19: 7,074,475 (GRCm39) probably benign Het
Fndc7 A G 3: 108,766,235 (GRCm39) probably benign Het
G3bp1 G A 11: 55,382,854 (GRCm39) G139D probably damaging Het
Gabra6 C T 11: 42,205,774 (GRCm39) V351I probably benign Het
Galc A T 12: 98,218,293 (GRCm39) H186Q probably damaging Het
Ganab A G 19: 8,890,177 (GRCm39) D702G possibly damaging Het
Hdac10 T C 15: 89,010,085 (GRCm39) E291G possibly damaging Het
Hectd3 T G 4: 116,859,810 (GRCm39) V749G probably damaging Het
Kash5 C T 7: 44,849,675 (GRCm39) A83T probably benign Het
Kcnh1 T A 1: 192,187,648 (GRCm39) I703N probably benign Het
Kcnma1 G A 14: 23,544,647 (GRCm39) T505I probably damaging Het
Kctd11 A G 11: 69,770,640 (GRCm39) C133R probably damaging Het
Lamb3 T C 1: 193,017,335 (GRCm39) L842P probably damaging Het
Ldlr T C 9: 21,649,295 (GRCm39) probably benign Het
Lipk G A 19: 34,024,210 (GRCm39) R336H probably benign Het
Lrrc24 T A 15: 76,607,409 (GRCm39) D58V probably damaging Het
Lrsam1 A G 2: 32,845,197 (GRCm39) L106P probably damaging Het
Milr1 G A 11: 106,645,722 (GRCm39) W88* probably null Het
Mmp10 A G 9: 7,506,544 (GRCm39) D340G probably damaging Het
Mybpc1 T A 10: 88,391,600 (GRCm39) Y285F possibly damaging Het
Ncoa3 A G 2: 165,896,320 (GRCm39) T408A probably benign Het
Nefm T A 14: 68,358,583 (GRCm39) K484* probably null Het
Nfasc A G 1: 132,529,721 (GRCm39) S814P probably damaging Het
Nlrp4a T C 7: 26,161,941 (GRCm39) V863A probably benign Het
Nos1 C T 5: 118,005,948 (GRCm39) P223S probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Or13c7 T A 4: 43,854,512 (GRCm39) S68T probably damaging Het
Or4c108 A T 2: 88,803,740 (GRCm39) L165Q probably damaging Het
Or5an6 A T 19: 12,372,327 (GRCm39) E233D probably benign Het
Or8k41 A G 2: 86,313,730 (GRCm39) S119P possibly damaging Het
Osbpl5 T C 7: 143,295,406 (GRCm39) probably null Het
Otog C A 7: 45,913,456 (GRCm39) probably null Het
Pacs1 A T 19: 5,206,402 (GRCm39) I261N possibly damaging Het
Pbx1 G A 1: 168,031,051 (GRCm39) T189I possibly damaging Het
Pcnx1 T C 12: 81,993,792 (GRCm39) I908T possibly damaging Het
Pdxdc1 A T 16: 13,697,309 (GRCm39) W124R probably damaging Het
Phex C A X: 155,969,214 (GRCm39) D587Y probably damaging Het
Plcb3 A T 19: 6,940,363 (GRCm39) D435E probably benign Het
Plce1 A C 19: 38,717,330 (GRCm39) K1373T probably damaging Het
Prkcd G A 14: 30,324,045 (GRCm39) A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 (GRCm39) S421T probably benign Het
Ptprs T C 17: 56,743,087 (GRCm39) probably null Het
Qrich1 A G 9: 108,411,333 (GRCm39) D286G probably damaging Het
Rcc1 C A 4: 132,060,226 (GRCm39) G393V probably damaging Het
Reln T C 5: 22,311,043 (GRCm39) N290S probably benign Het
Rgl1 T C 1: 152,430,175 (GRCm39) probably benign Het
Rhpn1 C T 15: 75,585,971 (GRCm39) T628I probably benign Het
Rilp A G 11: 75,401,747 (GRCm39) R176G probably benign Het
Riok3 C T 18: 12,288,284 (GRCm39) A487V probably benign Het
Rnf224 T C 2: 25,126,219 (GRCm39) T45A probably damaging Het
Rpa1 A G 11: 75,219,513 (GRCm39) V137A probably benign Het
Rps6ka1 C A 4: 133,575,842 (GRCm39) Q693H probably benign Het
Scn2a G T 2: 65,566,118 (GRCm39) V1381F probably benign Het
Scp2 T A 4: 107,955,275 (GRCm39) H112L probably benign Het
Sdk1 T C 5: 141,984,502 (GRCm39) W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 (GRCm39) V408F probably damaging Het
Slc28a2 T A 2: 122,285,008 (GRCm39) I332N probably benign Het
Slc37a3 A G 6: 39,314,172 (GRCm39) V480A probably benign Het
Slc45a4 T A 15: 73,453,755 (GRCm39) E674D probably benign Het
Smpd3 T C 8: 106,991,788 (GRCm39) E255G probably damaging Het
Snx29 C T 16: 11,478,417 (GRCm39) R658W probably damaging Het
Sppl2a A T 2: 126,762,256 (GRCm39) M275K probably benign Het
Stac T C 9: 111,464,089 (GRCm39) N59S probably damaging Het
Stk25 A T 1: 93,554,782 (GRCm39) L131Q probably damaging Het
Tep1 C T 14: 51,100,486 (GRCm39) probably benign Het
Thbs1 C A 2: 117,944,874 (GRCm39) N229K probably damaging Het
Tmx2 A T 2: 84,506,186 (GRCm39) H89Q probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tradd T C 8: 105,985,924 (GRCm39) N209S possibly damaging Het
Trappc3l A T 10: 33,974,928 (GRCm39) R119* probably null Het
Trmt1l G A 1: 151,333,205 (GRCm39) probably benign Het
Ublcp1 G T 11: 44,349,104 (GRCm39) Y243* probably null Het
Usp24 C A 4: 106,271,601 (GRCm39) C2158* probably null Het
Usp34 A T 11: 23,383,206 (GRCm39) K2088N probably damaging Het
Vmn1r53 G C 6: 90,200,925 (GRCm39) S133C probably damaging Het
Vmn2r52 A G 7: 9,893,327 (GRCm39) V604A probably damaging Het
Vmn2r93 A G 17: 18,525,061 (GRCm39) K240E probably benign Het
Wdr13 T G X: 7,994,284 (GRCm39) D242A probably damaging Het
Wwp1 C T 4: 19,641,734 (GRCm39) probably null Het
Zan G A 5: 137,396,624 (GRCm39) H4311Y unknown Het
Zc3h12c C A 9: 52,055,383 (GRCm39) R123L possibly damaging Het
Zfp125 A T 12: 20,950,562 (GRCm39) noncoding transcript Het
Zfp318 C T 17: 46,707,739 (GRCm39) P266S probably benign Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12,713,349 (GRCm39) missense probably benign
IGL00272:Lama3 APN 18 12,624,605 (GRCm39) missense probably damaging 1.00
IGL00335:Lama3 APN 18 12,582,645 (GRCm39) splice site probably benign
IGL00836:Lama3 APN 18 12,605,285 (GRCm39) missense probably benign 0.01
IGL01017:Lama3 APN 18 12,574,200 (GRCm39) critical splice donor site probably null
IGL01025:Lama3 APN 18 12,614,094 (GRCm39) missense probably benign 0.09
IGL01394:Lama3 APN 18 12,664,983 (GRCm39) missense probably null 0.39
IGL01545:Lama3 APN 18 12,574,188 (GRCm39) missense probably benign 0.01
IGL01685:Lama3 APN 18 12,586,937 (GRCm39) splice site probably benign
IGL01863:Lama3 APN 18 12,552,993 (GRCm39) splice site probably benign
IGL01869:Lama3 APN 18 12,657,820 (GRCm39) missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12,705,121 (GRCm39) missense probably benign 0.09
IGL02027:Lama3 APN 18 12,649,570 (GRCm39) missense probably damaging 1.00
IGL02106:Lama3 APN 18 12,601,371 (GRCm39) missense probably damaging 0.98
IGL02307:Lama3 APN 18 12,714,840 (GRCm39) missense probably benign 0.09
IGL02342:Lama3 APN 18 12,624,533 (GRCm39) missense probably damaging 1.00
IGL02377:Lama3 APN 18 12,689,807 (GRCm39) missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12,690,784 (GRCm39) missense probably benign 0.02
IGL02517:Lama3 APN 18 12,670,915 (GRCm39) critical splice donor site probably null
IGL02644:Lama3 APN 18 12,658,910 (GRCm39) missense probably benign 0.12
IGL02733:Lama3 APN 18 12,711,184 (GRCm39) missense probably damaging 0.99
IGL02932:Lama3 APN 18 12,661,858 (GRCm39) missense probably damaging 1.00
IGL03006:Lama3 APN 18 12,601,425 (GRCm39) splice site probably benign
IGL03038:Lama3 APN 18 12,552,307 (GRCm39) missense probably damaging 0.99
IGL03064:Lama3 APN 18 12,572,406 (GRCm39) missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12,660,681 (GRCm39) missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12,614,095 (GRCm39) missense probably damaging 1.00
IGL03255:Lama3 APN 18 12,672,760 (GRCm39) missense probably damaging 1.00
IGL03369:Lama3 APN 18 12,686,340 (GRCm39) missense probably benign 0.05
IGL03412:Lama3 APN 18 12,552,239 (GRCm39) missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12,686,288 (GRCm39) missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12,673,024 (GRCm39) missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12,630,938 (GRCm39) splice site probably benign
R0007:Lama3 UTSW 18 12,630,938 (GRCm39) splice site probably benign
R0050:Lama3 UTSW 18 12,537,160 (GRCm39) missense probably damaging 1.00
R0050:Lama3 UTSW 18 12,537,160 (GRCm39) missense probably damaging 1.00
R0063:Lama3 UTSW 18 12,661,762 (GRCm39) splice site probably benign
R0063:Lama3 UTSW 18 12,661,762 (GRCm39) splice site probably benign
R0106:Lama3 UTSW 18 12,537,039 (GRCm39) missense probably damaging 0.96
R0148:Lama3 UTSW 18 12,581,329 (GRCm39) missense probably damaging 1.00
R0165:Lama3 UTSW 18 12,657,867 (GRCm39) missense probably damaging 0.99
R0240:Lama3 UTSW 18 12,672,880 (GRCm39) splice site probably null
R0316:Lama3 UTSW 18 12,652,934 (GRCm39) missense probably benign 0.09
R0325:Lama3 UTSW 18 12,615,183 (GRCm39) missense probably damaging 1.00
R0365:Lama3 UTSW 18 12,640,064 (GRCm39) missense probably damaging 0.96
R0390:Lama3 UTSW 18 12,540,620 (GRCm39) missense probably benign 0.10
R0408:Lama3 UTSW 18 12,589,894 (GRCm39) missense probably benign
R0449:Lama3 UTSW 18 12,633,569 (GRCm39) splice site probably null
R0453:Lama3 UTSW 18 12,598,535 (GRCm39) missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12,583,481 (GRCm39) missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12,658,951 (GRCm39) missense probably damaging 1.00
R0545:Lama3 UTSW 18 12,694,758 (GRCm39) missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12,682,309 (GRCm39) missense probably benign
R0605:Lama3 UTSW 18 12,640,006 (GRCm39) missense probably benign 0.02
R0617:Lama3 UTSW 18 12,552,315 (GRCm39) critical splice donor site probably null
R0629:Lama3 UTSW 18 12,552,302 (GRCm39) missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12,610,647 (GRCm39) missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12,589,907 (GRCm39) splice site probably benign
R1216:Lama3 UTSW 18 12,554,191 (GRCm39) splice site probably benign
R1356:Lama3 UTSW 18 12,633,634 (GRCm39) unclassified probably benign
R1386:Lama3 UTSW 18 12,610,427 (GRCm39) missense probably benign 0.04
R1424:Lama3 UTSW 18 12,653,048 (GRCm39) missense probably benign 0.13
R1426:Lama3 UTSW 18 12,614,155 (GRCm39) critical splice donor site probably null
R1437:Lama3 UTSW 18 12,682,284 (GRCm39) missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12,574,164 (GRCm39) missense probably benign 0.00
R1468:Lama3 UTSW 18 12,574,164 (GRCm39) missense probably benign 0.00
R1472:Lama3 UTSW 18 12,615,102 (GRCm39) missense probably benign 0.23
R1557:Lama3 UTSW 18 12,646,788 (GRCm39) splice site probably benign
R1571:Lama3 UTSW 18 12,672,774 (GRCm39) missense probably damaging 0.98
R1599:Lama3 UTSW 18 12,583,457 (GRCm39) nonsense probably null
R1631:Lama3 UTSW 18 12,540,551 (GRCm39) missense probably damaging 1.00
R1647:Lama3 UTSW 18 12,665,256 (GRCm39) missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12,665,256 (GRCm39) missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12,612,929 (GRCm39) critical splice donor site probably null
R1757:Lama3 UTSW 18 12,598,556 (GRCm39) missense probably benign 0.10
R1766:Lama3 UTSW 18 12,535,119 (GRCm39) missense probably damaging 1.00
R1853:Lama3 UTSW 18 12,646,762 (GRCm39) missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12,670,838 (GRCm39) nonsense probably null
R1909:Lama3 UTSW 18 12,714,855 (GRCm39) missense probably benign 0.19
R1913:Lama3 UTSW 18 12,628,336 (GRCm39) missense probably benign 0.15
R1975:Lama3 UTSW 18 12,586,920 (GRCm39) missense probably damaging 1.00
R2014:Lama3 UTSW 18 12,657,778 (GRCm39) splice site probably benign
R2059:Lama3 UTSW 18 12,661,390 (GRCm39) missense probably damaging 0.98
R2060:Lama3 UTSW 18 12,661,783 (GRCm39) missense probably benign 0.30
R2086:Lama3 UTSW 18 12,657,887 (GRCm39) missense probably benign 0.39
R2115:Lama3 UTSW 18 12,535,906 (GRCm39) missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12,658,136 (GRCm39) missense probably damaging 0.98
R2860:Lama3 UTSW 18 12,586,807 (GRCm39) missense probably damaging 1.00
R2861:Lama3 UTSW 18 12,586,807 (GRCm39) missense probably damaging 1.00
R2862:Lama3 UTSW 18 12,586,807 (GRCm39) missense probably damaging 1.00
R3410:Lama3 UTSW 18 12,546,915 (GRCm39) critical splice donor site probably null
R3614:Lama3 UTSW 18 12,581,345 (GRCm39) missense probably benign 0.03
R3696:Lama3 UTSW 18 12,572,532 (GRCm39) splice site probably benign
R3752:Lama3 UTSW 18 12,640,086 (GRCm39) missense probably damaging 1.00
R3967:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R3968:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R3969:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R3970:Lama3 UTSW 18 12,713,398 (GRCm39) missense probably damaging 1.00
R4088:Lama3 UTSW 18 12,637,365 (GRCm39) nonsense probably null
R4118:Lama3 UTSW 18 12,583,488 (GRCm39) missense probably benign 0.01
R4222:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4223:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4224:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4225:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R4367:Lama3 UTSW 18 12,646,747 (GRCm39) missense probably damaging 1.00
R4404:Lama3 UTSW 18 12,715,588 (GRCm39) missense probably benign 0.01
R4424:Lama3 UTSW 18 12,652,929 (GRCm39) nonsense probably null
R4483:Lama3 UTSW 18 12,682,310 (GRCm39) missense probably benign 0.32
R4484:Lama3 UTSW 18 12,614,145 (GRCm39) missense probably benign
R4516:Lama3 UTSW 18 12,628,415 (GRCm39) missense probably damaging 1.00
R4556:Lama3 UTSW 18 12,612,816 (GRCm39) missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12,637,454 (GRCm39) critical splice donor site probably null
R4702:Lama3 UTSW 18 12,711,086 (GRCm39) nonsense probably null
R4704:Lama3 UTSW 18 12,686,280 (GRCm39) missense probably benign 0.08
R4750:Lama3 UTSW 18 12,637,416 (GRCm39) missense probably benign 0.25
R4753:Lama3 UTSW 18 12,615,141 (GRCm39) missense probably damaging 1.00
R4767:Lama3 UTSW 18 12,633,620 (GRCm39) missense probably benign 0.32
R4777:Lama3 UTSW 18 12,546,828 (GRCm39) missense probably damaging 1.00
R4782:Lama3 UTSW 18 12,544,627 (GRCm39) nonsense probably null
R4784:Lama3 UTSW 18 12,582,601 (GRCm39) missense probably benign 0.20
R4816:Lama3 UTSW 18 12,610,661 (GRCm39) missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12,574,188 (GRCm39) missense probably benign 0.01
R4854:Lama3 UTSW 18 12,544,599 (GRCm39) missense probably benign 0.00
R4863:Lama3 UTSW 18 12,631,735 (GRCm39) intron probably benign
R4863:Lama3 UTSW 18 12,672,850 (GRCm39) missense probably damaging 0.99
R4953:Lama3 UTSW 18 12,581,362 (GRCm39) missense probably damaging 1.00
R4974:Lama3 UTSW 18 12,685,883 (GRCm39) missense probably damaging 0.98
R4996:Lama3 UTSW 18 12,651,800 (GRCm39) missense probably benign 0.24
R5049:Lama3 UTSW 18 12,715,668 (GRCm39) missense probably benign 0.19
R5057:Lama3 UTSW 18 12,665,005 (GRCm39) missense probably null 0.82
R5090:Lama3 UTSW 18 12,675,459 (GRCm39) missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12,672,823 (GRCm39) missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12,710,957 (GRCm39) missense probably damaging 1.00
R5245:Lama3 UTSW 18 12,552,950 (GRCm39) missense probably damaging 1.00
R5259:Lama3 UTSW 18 12,598,565 (GRCm39) missense probably damaging 1.00
R5320:Lama3 UTSW 18 12,685,912 (GRCm39) missense probably damaging 0.99
R5377:Lama3 UTSW 18 12,586,803 (GRCm39) missense probably damaging 0.99
R5432:Lama3 UTSW 18 12,705,123 (GRCm39) missense probably damaging 1.00
R5500:Lama3 UTSW 18 12,589,821 (GRCm39) missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12,686,267 (GRCm39) missense probably benign 0.00
R5589:Lama3 UTSW 18 12,605,277 (GRCm39) missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12,572,405 (GRCm39) missense probably benign
R5617:Lama3 UTSW 18 12,631,993 (GRCm39) intron probably benign
R5709:Lama3 UTSW 18 12,672,856 (GRCm39) missense probably damaging 1.00
R5965:Lama3 UTSW 18 12,562,944 (GRCm39) missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12,707,311 (GRCm39) missense probably damaging 1.00
R6065:Lama3 UTSW 18 12,602,985 (GRCm39) missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12,615,156 (GRCm39) missense probably benign 0.01
R6212:Lama3 UTSW 18 12,646,702 (GRCm39) missense probably damaging 1.00
R6268:Lama3 UTSW 18 12,657,794 (GRCm39) missense probably damaging 0.98
R6276:Lama3 UTSW 18 12,640,006 (GRCm39) missense probably benign 0.02
R6366:Lama3 UTSW 18 12,615,194 (GRCm39) missense probably damaging 1.00
R6393:Lama3 UTSW 18 12,612,813 (GRCm39) missense probably benign 0.44
R6493:Lama3 UTSW 18 12,615,205 (GRCm39) critical splice donor site probably null
R6505:Lama3 UTSW 18 12,628,405 (GRCm39) missense probably benign 0.02
R6563:Lama3 UTSW 18 12,670,823 (GRCm39) missense probably damaging 1.00
R6582:Lama3 UTSW 18 12,710,897 (GRCm39) missense probably damaging 1.00
R6585:Lama3 UTSW 18 12,552,314 (GRCm39) critical splice donor site probably null
R6609:Lama3 UTSW 18 12,646,735 (GRCm39) missense probably damaging 0.99
R6656:Lama3 UTSW 18 12,682,283 (GRCm39) missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12,624,605 (GRCm39) missense probably damaging 1.00
R6834:Lama3 UTSW 18 12,624,605 (GRCm39) missense probably damaging 1.00
R7019:Lama3 UTSW 18 12,661,475 (GRCm39) missense probably damaging 0.97
R7026:Lama3 UTSW 18 12,649,605 (GRCm39) missense probably damaging 0.98
R7088:Lama3 UTSW 18 12,715,602 (GRCm39) missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12,715,701 (GRCm39) missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12,685,870 (GRCm39) missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12,664,936 (GRCm39) missense probably benign 0.00
R7121:Lama3 UTSW 18 12,595,839 (GRCm39) missense probably benign 0.06
R7133:Lama3 UTSW 18 12,672,843 (GRCm39) missense probably benign 0.05
R7150:Lama3 UTSW 18 12,601,346 (GRCm39) missense probably damaging 1.00
R7158:Lama3 UTSW 18 12,589,869 (GRCm39) missense probably benign 0.20
R7170:Lama3 UTSW 18 12,537,133 (GRCm39) missense probably benign 0.26
R7216:Lama3 UTSW 18 12,563,057 (GRCm39) missense probably damaging 1.00
R7223:Lama3 UTSW 18 12,715,665 (GRCm39) missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12,552,902 (GRCm39) missense probably damaging 1.00
R7282:Lama3 UTSW 18 12,572,449 (GRCm39) missense probably damaging 0.99
R7337:Lama3 UTSW 18 12,640,097 (GRCm39) splice site probably null
R7442:Lama3 UTSW 18 12,605,238 (GRCm39) critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12,552,294 (GRCm39) missense probably benign
R7604:Lama3 UTSW 18 12,633,550 (GRCm39) missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12,664,891 (GRCm39) critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12,670,895 (GRCm39) missense probably benign 0.01
R7894:Lama3 UTSW 18 12,595,864 (GRCm39) missense probably benign 0.07
R7975:Lama3 UTSW 18 12,670,796 (GRCm39) missense probably damaging 1.00
R8099:Lama3 UTSW 18 12,667,120 (GRCm39) missense probably damaging 0.97
R8168:Lama3 UTSW 18 12,639,999 (GRCm39) missense probably null
R8219:Lama3 UTSW 18 12,572,417 (GRCm39) missense probably benign 0.07
R8227:Lama3 UTSW 18 12,540,608 (GRCm39) missense probably benign
R8229:Lama3 UTSW 18 12,540,608 (GRCm39) missense probably benign
R8298:Lama3 UTSW 18 12,658,910 (GRCm39) missense probably benign 0.12
R8351:Lama3 UTSW 18 12,673,670 (GRCm39) missense probably damaging 1.00
R8364:Lama3 UTSW 18 12,661,404 (GRCm39) missense probably damaging 0.99
R8463:Lama3 UTSW 18 12,582,896 (GRCm39) missense probably damaging 0.96
R8515:Lama3 UTSW 18 12,544,688 (GRCm39) missense probably null 0.01
R8784:Lama3 UTSW 18 12,554,212 (GRCm39) missense probably benign
R8799:Lama3 UTSW 18 12,624,000 (GRCm39) missense probably damaging 0.96
R8874:Lama3 UTSW 18 12,582,643 (GRCm39) critical splice donor site probably null
R8938:Lama3 UTSW 18 12,689,762 (GRCm39) missense probably damaging 1.00
R8967:Lama3 UTSW 18 12,665,096 (GRCm39) missense possibly damaging 0.46
R9039:Lama3 UTSW 18 12,614,120 (GRCm39) nonsense probably null
R9126:Lama3 UTSW 18 12,583,527 (GRCm39) missense probably damaging 1.00
R9200:Lama3 UTSW 18 12,605,297 (GRCm39) missense probably benign 0.00
R9203:Lama3 UTSW 18 12,595,869 (GRCm39) missense probably benign 0.04
R9246:Lama3 UTSW 18 12,710,959 (GRCm39) missense probably damaging 0.99
R9284:Lama3 UTSW 18 12,583,541 (GRCm39) nonsense probably null
R9553:Lama3 UTSW 18 12,563,019 (GRCm39) missense probably damaging 1.00
R9716:Lama3 UTSW 18 12,583,460 (GRCm39) missense probably damaging 1.00
R9734:Lama3 UTSW 18 12,682,320 (GRCm39) missense possibly damaging 0.94
X0019:Lama3 UTSW 18 12,715,631 (GRCm39) missense possibly damaging 0.94
Z1177:Lama3 UTSW 18 12,562,936 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGGTAACTCAGTCCACAGCCTC -3'
(R):5'- CCGCCGACGTAAAATACTGCATTC -3'

Sequencing Primer
(F):5'- gtctgtctgtctgtctgtctg -3'
(R):5'- CGACGTAAAATACTGCATTCTCAGG -3'
Posted On 2013-07-11