Incidental Mutation 'R7695:Lrrc14b'
ID593620
Institutional Source Beutler Lab
Gene Symbol Lrrc14b
Ensembl Gene ENSMUSG00000021579
Gene Nameleucine rich repeat containing 14B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74359578-74364005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74363178 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 261 (D261V)
Ref Sequence ENSEMBL: ENSMUSP00000022064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022063] [ENSMUST00000022064] [ENSMUST00000159931] [ENSMUST00000160021] [ENSMUST00000162672]
Predicted Effect probably benign
Transcript: ENSMUST00000022063
SMART Domains Protein: ENSMUSP00000022063
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
coiled coil region 78 140 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000022064
AA Change: D261V

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022064
Gene: ENSMUSG00000021579
AA Change: D261V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 208 417 8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159931
SMART Domains Protein: ENSMUSP00000124009
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160021
SMART Domains Protein: ENSMUSP00000124193
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Lrrc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Lrrc14b APN 13 74360959 missense probably damaging 0.97
IGL01521:Lrrc14b APN 13 74363572 missense probably damaging 1.00
IGL03156:Lrrc14b APN 13 74363904 missense probably benign
R0457:Lrrc14b UTSW 13 74361160 missense probably benign 0.41
R1631:Lrrc14b UTSW 13 74361254 splice site probably null
R1741:Lrrc14b UTSW 13 74363586 missense probably damaging 1.00
R2042:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2047:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2149:Lrrc14b UTSW 13 74363757 missense possibly damaging 0.63
R3083:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R3838:Lrrc14b UTSW 13 74363545 missense possibly damaging 0.86
R3892:Lrrc14b UTSW 13 74363668 missense probably benign 0.00
R5748:Lrrc14b UTSW 13 74363640 missense probably damaging 1.00
R6508:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R6663:Lrrc14b UTSW 13 74361361 missense probably damaging 1.00
R6687:Lrrc14b UTSW 13 74360762 missense probably benign 0.00
R7309:Lrrc14b UTSW 13 74363202 missense probably benign 0.08
R7472:Lrrc14b UTSW 13 74363107 missense probably damaging 1.00
R7574:Lrrc14b UTSW 13 74360773 missense probably damaging 0.98
R7629:Lrrc14b UTSW 13 74361164 missense probably benign 0.03
R8169:Lrrc14b UTSW 13 74363167 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CACATTCCCAGAGAACATTGTG -3'
(R):5'- CAGCTCCTACAAGTTCTTGGC -3'

Sequencing Primer
(F):5'- TGTGTAAACAGATCCTATCCCTG -3'
(R):5'- ACAAGTTCTTGGCCTGGC -3'
Posted On2019-11-12