Incidental Mutation 'R7695:Pkd2l2'
ID593631
Institutional Source Beutler Lab
Gene Symbol Pkd2l2
Ensembl Gene ENSMUSG00000014503
Gene Namepolycystic kidney disease 2-like 2
SynonymsTRPP5, Polycystin - L2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7695 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location34409423-34442789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34428245 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 435 (D435E)
Ref Sequence ENSEMBL: ENSMUSP00000014647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000166156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014647
AA Change: D435E

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503
AA Change: D435E

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166156
AA Change: D435E

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503
AA Change: D435E

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted gene disruption display hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sh3pxd2a T A 19: 47,267,831 Y844F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Pkd2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Pkd2l2 APN 18 34417015 missense probably damaging 1.00
IGL01943:Pkd2l2 APN 18 34417036 missense probably damaging 1.00
IGL02039:Pkd2l2 APN 18 34435368 critical splice donor site probably null
IGL02139:Pkd2l2 APN 18 34412715 nonsense probably null
IGL02480:Pkd2l2 APN 18 34438790 missense possibly damaging 0.48
IGL02742:Pkd2l2 APN 18 34416917 nonsense probably null
IGL02818:Pkd2l2 APN 18 34412809 missense probably damaging 0.97
IGL03218:Pkd2l2 APN 18 34430320 missense probably damaging 1.00
IGL03345:Pkd2l2 APN 18 34425089 missense probably damaging 1.00
R0362:Pkd2l2 UTSW 18 34435327 missense probably benign 0.03
R0627:Pkd2l2 UTSW 18 34425102 missense probably damaging 1.00
R0883:Pkd2l2 UTSW 18 34430268 splice site probably null
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0974:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R1199:Pkd2l2 UTSW 18 34438216 critical splice donor site probably null
R1529:Pkd2l2 UTSW 18 34430702 missense probably damaging 1.00
R1579:Pkd2l2 UTSW 18 34427393 missense possibly damaging 0.49
R2229:Pkd2l2 UTSW 18 34430329 missense probably damaging 1.00
R3695:Pkd2l2 UTSW 18 34438790 missense possibly damaging 0.48
R4058:Pkd2l2 UTSW 18 34428192 missense probably benign 0.22
R4600:Pkd2l2 UTSW 18 34438201 missense probably benign 0.03
R4651:Pkd2l2 UTSW 18 34409836 nonsense probably null
R4652:Pkd2l2 UTSW 18 34409836 nonsense probably null
R5114:Pkd2l2 UTSW 18 34433302 missense probably benign
R5341:Pkd2l2 UTSW 18 34409934 splice site probably null
R5686:Pkd2l2 UTSW 18 34425237 missense probably damaging 1.00
R5920:Pkd2l2 UTSW 18 34430773 missense probably benign
R6061:Pkd2l2 UTSW 18 34430689 missense probably damaging 1.00
R6167:Pkd2l2 UTSW 18 34428244 missense probably damaging 1.00
R6217:Pkd2l2 UTSW 18 34414680 missense probably benign 0.03
R6293:Pkd2l2 UTSW 18 34427444 missense probably damaging 1.00
R6572:Pkd2l2 UTSW 18 34438771 missense probably damaging 0.99
R6574:Pkd2l2 UTSW 18 34425081 missense probably damaging 1.00
R6723:Pkd2l2 UTSW 18 34438157 missense probably damaging 0.98
R6941:Pkd2l2 UTSW 18 34416883 missense probably benign 0.02
R6958:Pkd2l2 UTSW 18 34409490 nonsense probably null
R7052:Pkd2l2 UTSW 18 34425159 missense possibly damaging 0.90
R7763:Pkd2l2 UTSW 18 34433287 critical splice acceptor site probably null
R7777:Pkd2l2 UTSW 18 34416860 missense probably damaging 1.00
R7944:Pkd2l2 UTSW 18 34427428 missense possibly damaging 0.90
R8003:Pkd2l2 UTSW 18 34428179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATTTACTGGACTCTAAACAGCCCC -3'
(R):5'- TTAGTTCTCAGGTGGCAGACG -3'

Sequencing Primer
(F):5'- ACTGGAACGCACTGACTCTTG -3'
(R):5'- CAGACGTCGTTTGCATGGC -3'
Posted On2019-11-12