Incidental Mutation 'R7695:Sh3pxd2a'
ID 593636
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2a
Ensembl Gene ENSMUSG00000053617
Gene Name SH3 and PX domains 2A
Synonyms Tks5, Fish, Sh3md1, 2310014D11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7695 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 47260174-47464411 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47267831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 844 (Y844F)
Ref Sequence ENSEMBL: ENSMUSP00000080325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081619] [ENSMUST00000111800]
AlphaFold O89032
Predicted Effect probably damaging
Transcript: ENSMUST00000081619
AA Change: Y844F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080325
Gene: ENSMUSG00000053617
AA Change: Y844F

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
low complexity region 242 254 N/A INTRINSIC
SH3 269 324 6.49e-16 SMART
low complexity region 360 371 N/A INTRINSIC
SH3 450 505 4.49e-10 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 654 676 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
SH3 836 891 2.41e-10 SMART
SH3 1066 1124 3.85e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111800
AA Change: Y816F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107430
Gene: ENSMUSG00000053617
AA Change: Y816F

DomainStartEndE-ValueType
PX 3 124 3.6e-32 SMART
SH3 169 224 3.24e-16 SMART
SH3 241 296 6.49e-16 SMART
low complexity region 332 343 N/A INTRINSIC
SH3 422 477 4.49e-10 SMART
low complexity region 491 509 N/A INTRINSIC
low complexity region 604 624 N/A INTRINSIC
low complexity region 626 648 N/A INTRINSIC
low complexity region 657 681 N/A INTRINSIC
SH3 808 863 2.41e-10 SMART
SH3 1038 1096 3.85e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in high neonatal lethality associated with a complete cleft of the secondary palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T C 13: 98,984,258 T87A probably damaging Het
Adgrb1 T C 15: 74,543,638 V689A possibly damaging Het
Casp12 A G 9: 5,353,641 E225G probably damaging Het
Ccdc39 A G 3: 33,814,519 L806P probably damaging Het
Ccnd3 T A 17: 47,597,496 I164N probably damaging Het
Cd209b A G 8: 3,926,005 V52A probably benign Het
Celsr2 G A 3: 108,402,753 R1554W probably damaging Het
Cnot1 A T 8: 95,770,632 I239N probably benign Het
Csmd3 A T 15: 47,820,381 V948D Het
Dnmt1 C A 9: 20,913,985 G1061V probably null Het
Dpysl4 A G 7: 139,086,123 M1V probably null Het
Elp5 T C 11: 69,969,501 T227A probably benign Het
Exosc1 G A 19: 41,928,080 H86Y possibly damaging Het
Foxn4 G T 5: 114,256,587 D426E probably damaging Het
Gabbr2 A G 4: 46,875,687 L145P probably damaging Het
Gkn3 A G 6: 87,384,440 Y126H probably damaging Het
Gm16506 A G 14: 43,725,006 F148S Het
Gm3558 A G 14: 7,551,798 I76T probably benign Het
Gm49359 A G 13: 62,456,744 F45S possibly damaging Het
Gpc5 A T 14: 115,092,594 H63L unknown Het
Hbs1l A T 10: 21,299,217 D28V possibly damaging Het
Ide G A 19: 37,329,036 H113Y Het
Igkv3-3 A T 6: 70,687,311 S46C probably damaging Het
Igsf10 A T 3: 59,326,191 V1707D probably damaging Het
Kcna5 A T 6: 126,534,211 V318E probably damaging Het
Kdm3b T C 18: 34,794,559 F158S possibly damaging Het
Lrrc14b T A 13: 74,363,178 D261V possibly damaging Het
Lrrc71 T A 3: 87,739,462 I485F probably damaging Het
Map6 C T 7: 99,336,292 L671F possibly damaging Het
Mast1 A G 8: 84,920,928 V560A probably damaging Het
Mfap4 A T 11: 61,485,719 probably null Het
Myh9 A G 15: 77,766,736 I1637T probably benign Het
Neo1 A T 9: 58,902,929 F1080I possibly damaging Het
Olfr1269 A G 2: 90,118,863 V245A probably benign Het
Olfr1298 A G 2: 111,645,625 V124A probably damaging Het
Olfr23 T A 11: 73,940,894 V216E possibly damaging Het
Olfr559 T C 7: 102,723,659 H277R probably benign Het
Pax2 A G 19: 44,833,199 Y318C probably damaging Het
Pcnx4 A T 12: 72,541,576 M53L probably benign Het
Pkd2l2 T A 18: 34,428,245 D435E possibly damaging Het
Plec G A 15: 76,183,855 Q1117* probably null Het
Ppp2r2c T C 5: 36,947,182 L302P probably damaging Het
Prex2 T C 1: 11,162,273 F855L probably benign Het
Reg3d A T 6: 78,377,136 W103R probably benign Het
Rnf216 A C 5: 143,085,904 H440Q possibly damaging Het
Scn2a A G 2: 65,711,907 T785A probably damaging Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Spp1 T C 5: 104,435,143 probably benign Het
Tacc2 T A 7: 130,728,903 S196T probably benign Het
Thrap3 G A 4: 126,180,098 S285L probably damaging Het
Ttn T A 2: 76,835,961 R11584* probably null Het
Ubap2 A G 4: 41,211,740 S341P probably damaging Het
Upf3a T G 8: 13,798,279 S358R probably benign Het
Zdbf2 T A 1: 63,307,370 I1636N possibly damaging Het
Zfp946 C A 17: 22,455,021 T252N probably benign Het
Other mutations in Sh3pxd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Sh3pxd2a APN 19 47314155 missense probably benign 0.20
IGL01606:Sh3pxd2a APN 19 47268596 missense probably benign
IGL02001:Sh3pxd2a APN 19 47273447 missense probably damaging 0.99
IGL02060:Sh3pxd2a APN 19 47373378 splice site probably benign
IGL02830:Sh3pxd2a APN 19 47283078 missense probably damaging 1.00
IGL03240:Sh3pxd2a APN 19 47268026 missense probably damaging 1.00
IGL03263:Sh3pxd2a APN 19 47314043 missense probably damaging 1.00
IGL03290:Sh3pxd2a APN 19 47424516 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0045:Sh3pxd2a UTSW 19 47267183 missense probably damaging 1.00
R0504:Sh3pxd2a UTSW 19 47267747 missense probably damaging 1.00
R0683:Sh3pxd2a UTSW 19 47267511 missense probably benign 0.04
R0726:Sh3pxd2a UTSW 19 47268762 missense probably damaging 1.00
R0883:Sh3pxd2a UTSW 19 47268207 missense probably damaging 1.00
R1276:Sh3pxd2a UTSW 19 47268383 missense probably benign
R1349:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1372:Sh3pxd2a UTSW 19 47267721 missense probably damaging 1.00
R1525:Sh3pxd2a UTSW 19 47278425 missense probably damaging 1.00
R1661:Sh3pxd2a UTSW 19 47278320 missense probably damaging 1.00
R1664:Sh3pxd2a UTSW 19 47268382 missense probably benign 0.02
R1766:Sh3pxd2a UTSW 19 47273250 missense probably benign 0.01
R1931:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R1932:Sh3pxd2a UTSW 19 47267508 missense probably benign 0.00
R2024:Sh3pxd2a UTSW 19 47267264 missense probably benign 0.35
R2165:Sh3pxd2a UTSW 19 47278355 missense probably damaging 1.00
R2210:Sh3pxd2a UTSW 19 47267343 missense possibly damaging 0.93
R2567:Sh3pxd2a UTSW 19 47424569 missense possibly damaging 0.94
R4097:Sh3pxd2a UTSW 19 47424512 missense probably damaging 1.00
R4466:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R4788:Sh3pxd2a UTSW 19 47314079 missense probably damaging 1.00
R4885:Sh3pxd2a UTSW 19 47268693 missense probably damaging 1.00
R4939:Sh3pxd2a UTSW 19 47278404 missense probably damaging 1.00
R5184:Sh3pxd2a UTSW 19 47273411 missense possibly damaging 0.90
R5340:Sh3pxd2a UTSW 19 47268231 missense probably benign 0.36
R5673:Sh3pxd2a UTSW 19 47268666 missense probably damaging 1.00
R5925:Sh3pxd2a UTSW 19 47267612 missense probably damaging 1.00
R5988:Sh3pxd2a UTSW 19 47364638 missense probably benign 0.16
R6120:Sh3pxd2a UTSW 19 47267409 missense probably damaging 0.99
R6432:Sh3pxd2a UTSW 19 47269927 missense probably damaging 0.99
R6650:Sh3pxd2a UTSW 19 47268224 missense probably benign 0.00
R6700:Sh3pxd2a UTSW 19 47364707 missense possibly damaging 0.61
R6831:Sh3pxd2a UTSW 19 47283093 missense probably damaging 1.00
R7015:Sh3pxd2a UTSW 19 47268123 missense probably benign 0.00
R7225:Sh3pxd2a UTSW 19 47267389 missense probably damaging 1.00
R7449:Sh3pxd2a UTSW 19 47267652 missense probably benign
R7904:Sh3pxd2a UTSW 19 47320314 missense possibly damaging 0.54
R8143:Sh3pxd2a UTSW 19 47268699 missense probably damaging 1.00
R8268:Sh3pxd2a UTSW 19 47267594 missense probably benign
R8290:Sh3pxd2a UTSW 19 47314136 missense probably damaging 1.00
R8350:Sh3pxd2a UTSW 19 47268707 missense probably damaging 1.00
R8350:Sh3pxd2a UTSW 19 47269838 missense probably null 0.72
R8742:Sh3pxd2a UTSW 19 47286634 missense probably benign 0.01
R8767:Sh3pxd2a UTSW 19 47268906 missense probably damaging 1.00
R8948:Sh3pxd2a UTSW 19 47373443 missense probably damaging 1.00
R9357:Sh3pxd2a UTSW 19 47272009 missense probably damaging 1.00
R9433:Sh3pxd2a UTSW 19 47267100 missense probably damaging 0.98
R9515:Sh3pxd2a UTSW 19 47267171 missense probably damaging 1.00
R9748:Sh3pxd2a UTSW 19 47268654 missense probably benign
V3553:Sh3pxd2a UTSW 19 47267219 missense probably benign 0.12
X0013:Sh3pxd2a UTSW 19 47267864 missense probably benign 0.01
X0026:Sh3pxd2a UTSW 19 47464150 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTTTGCTAGCTGTGTCAGG -3'
(R):5'- AAAGCCAGTCCTGAACCGAG -3'

Sequencing Primer
(F):5'- CAGGTTGCTGGTTCTCCTCG -3'
(R):5'- GATATTAGTTCCTTACGGCGCCAG -3'
Posted On 2019-11-12