Incidental Mutation 'R7696:Cyp27a1'
ID 593637
Institutional Source Beutler Lab
Gene Symbol Cyp27a1
Ensembl Gene ENSMUSG00000026170
Gene Name cytochrome P450, family 27, subfamily a, polypeptide 1
Synonyms cholesterol 27 hydroxylase, Cyp27, 1300013A03Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R7696 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74713574-74737892 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74732039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 128 (I128L)
Ref Sequence ENSEMBL: ENSMUSP00000027356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027356]
AlphaFold Q9DBG1
Predicted Effect probably benign
Transcript: ENSMUST00000027356
AA Change: I128L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027356
Gene: ENSMUSG00000026170
AA Change: I128L

DomainStartEndE-ValueType
Pfam:p450 63 529 5.1e-107 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This mitochondrial protein oxidizes cholesterol intermediates as part of the bile synthesis pathway. Since the conversion of cholesterol to bile acids is the major route for removing cholesterol from the body, this protein is important for overall cholesterol homeostasis. Mutations in this gene cause cerebrotendinous xanthomatosis, a rare autosomal recessive lipid storage disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null allele show hepato- and adrenomegaly, reduced bile acid synthesis, increased cholesterol 7alpha-hydroxylase activity and 7alpha-hydroxycholesterol levels, slightly higher 25-hydroxyvitamin D levels, and altered hepatic fatty acid, triacylglycerol, and adrenal cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A G 8: 129,219,313 Y344H probably benign Het
Adamts12 C T 15: 11,258,138 R512C probably damaging Het
Afap1l2 C A 19: 56,914,486 V754L probably damaging Het
Atp5a1 T A 18: 77,780,986 I393N probably damaging Het
Bbs1 C T 19: 4,890,989 probably null Het
Bglap2 A T 3: 88,378,616 L12Q unknown Het
Bsn C T 9: 108,114,501 V1351I probably damaging Het
Cbx1 T C 11: 96,806,642 V147A probably damaging Het
Cep192 T A 18: 67,820,363 S484T probably damaging Het
Col18a1 A T 10: 77,085,272 I298K unknown Het
Dhdds C T 4: 133,996,914 A30T probably damaging Het
Dnajc12 A G 10: 63,407,132 N143S probably benign Het
Eno3 T G 11: 70,661,983 N363K probably benign Het
Galnt10 T A 11: 57,769,538 D267E probably damaging Het
Galr2 C T 11: 116,283,167 R208C probably damaging Het
Hif3a G A 7: 17,054,787 R82C unknown Het
Hspg2 T A 4: 137,511,966 F401L possibly damaging Het
Iars G T 13: 49,706,738 W455L probably damaging Het
Irf1 C T 11: 53,776,336 H294Y probably benign Het
Itgal T C 7: 127,330,184 L1091P probably damaging Het
Lrrc37a T G 11: 103,498,437 D2054A probably benign Het
Map3k2 T A 18: 32,220,594 H472Q probably benign Het
Myo18b T C 5: 112,692,292 D2545G probably damaging Het
Nle1 G T 11: 82,904,966 Y218* probably null Het
Pdlim5 A T 3: 142,277,862 S377T probably benign Het
Plch1 A T 3: 63,755,305 M259K probably benign Het
Pou6f1 A G 15: 100,584,098 V268A probably benign Het
Prn C A 2: 131,946,445 L7I unknown Het
Prpf6 C T 2: 181,608,242 A65V possibly damaging Het
Rarres1 A T 3: 67,491,012 F138L probably benign Het
Ros1 C T 10: 52,142,283 V781M probably damaging Het
Sec16a C A 2: 26,415,633 probably null Het
Slc44a4 G A 17: 34,928,700 G606D probably damaging Het
Slco1a4 A T 6: 141,810,511 C538* probably null Het
Slco1c1 A G 6: 141,567,610 Y537C probably benign Het
Speg T A 1: 75,429,161 L3003Q probably damaging Het
Ssr3 A G 3: 65,392,465 S25P probably benign Het
Stard13 C A 5: 151,060,802 R623L probably damaging Het
Tbc1d5 A G 17: 50,874,577 I376T probably damaging Het
Tigd4 C A 3: 84,594,917 F380L possibly damaging Het
Tmc4 T C 7: 3,669,575 K489E probably damaging Het
Tmem114 C T 16: 8,424,489 R55H probably benign Het
Tmem168 A G 6: 13,602,938 I143T probably benign Het
Tmem87b C T 2: 128,841,317 T397I probably damaging Het
Tom1l1 C A 11: 90,672,915 R173L probably benign Het
Trim10 G A 17: 36,871,752 R170K probably damaging Het
Usp6nl T A 2: 6,424,323 Y222N probably damaging Het
Vmn2r26 A T 6: 124,061,535 I690F possibly damaging Het
Other mutations in Cyp27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cyp27a1 APN 1 74731938 missense possibly damaging 0.88
IGL01824:Cyp27a1 APN 1 74735881 nonsense probably null
IGL02725:Cyp27a1 APN 1 74735703 missense probably damaging 0.98
IGL02966:Cyp27a1 APN 1 74732090 missense probably benign
IGL03067:Cyp27a1 APN 1 74731909 splice site probably null
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R0103:Cyp27a1 UTSW 1 74735915 missense probably benign
R1968:Cyp27a1 UTSW 1 74737276 missense probably benign 0.00
R2271:Cyp27a1 UTSW 1 74736687 missense probably damaging 1.00
R3847:Cyp27a1 UTSW 1 74737559 missense probably damaging 0.99
R4735:Cyp27a1 UTSW 1 74737207 missense possibly damaging 0.94
R4936:Cyp27a1 UTSW 1 74735405 missense probably benign 0.35
R5849:Cyp27a1 UTSW 1 74736684 missense probably damaging 1.00
R6129:Cyp27a1 UTSW 1 74735692 missense probably benign 0.24
R6193:Cyp27a1 UTSW 1 74737072 missense probably benign 0.00
R6344:Cyp27a1 UTSW 1 74736849 critical splice donor site probably null
R6464:Cyp27a1 UTSW 1 74735888 missense possibly damaging 0.61
R7226:Cyp27a1 UTSW 1 74737348 missense probably damaging 1.00
R7337:Cyp27a1 UTSW 1 74735435 missense probably damaging 1.00
R7959:Cyp27a1 UTSW 1 74737077 missense probably benign 0.07
R8258:Cyp27a1 UTSW 1 74732055 missense probably benign 0.22
R8259:Cyp27a1 UTSW 1 74732055 missense probably benign 0.22
R9352:Cyp27a1 UTSW 1 74713761 missense possibly damaging 0.92
Z1177:Cyp27a1 UTSW 1 74737335 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAATGTCATCTCAACTGG -3'
(R):5'- AAGAGGCAGTGGCTGTTCTG -3'

Sequencing Primer
(F):5'- GGACCCCAGTTATTCCACTTTGG -3'
(R):5'- GCCTCAACGTTTTCTAGACAAG -3'
Posted On 2019-11-12