Incidental Mutation 'R7696:Prpf6'
ID 593643
Institutional Source Beutler Lab
Gene Symbol Prpf6
Ensembl Gene ENSMUSG00000002455
Gene Name pre-mRNA splicing factor 6
Synonyms ANT-1, U5-102K, 2610031L17Rik, 1190003A07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7696 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 181591868-181655660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 181608242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 65 (A65V)
Ref Sequence ENSEMBL: ENSMUSP00000002529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002529] [ENSMUST00000132714] [ENSMUST00000136481]
AlphaFold Q91YR7
Predicted Effect possibly damaging
Transcript: ENSMUST00000002529
AA Change: A65V

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002529
Gene: ENSMUSG00000002455
AA Change: A65V

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 2.5e-52 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000132714
AA Change: A6V

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117711
Gene: ENSMUSG00000002455
AA Change: A6V

DomainStartEndE-ValueType
Pfam:PRP1_N 1 54 6e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136481
AA Change: A65V

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121340
Gene: ENSMUSG00000002455
AA Change: A65V

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 1.3e-62 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A G 8: 129,219,313 Y344H probably benign Het
Adamts12 C T 15: 11,258,138 R512C probably damaging Het
Afap1l2 C A 19: 56,914,486 V754L probably damaging Het
Atp5a1 T A 18: 77,780,986 I393N probably damaging Het
Bbs1 C T 19: 4,890,989 probably null Het
Bglap2 A T 3: 88,378,616 L12Q unknown Het
Bsn C T 9: 108,114,501 V1351I probably damaging Het
Cbx1 T C 11: 96,806,642 V147A probably damaging Het
Cep192 T A 18: 67,820,363 S484T probably damaging Het
Col18a1 A T 10: 77,085,272 I298K unknown Het
Cyp27a1 A T 1: 74,732,039 I128L probably benign Het
Dhdds C T 4: 133,996,914 A30T probably damaging Het
Dnajc12 A G 10: 63,407,132 N143S probably benign Het
Eno3 T G 11: 70,661,983 N363K probably benign Het
Galnt10 T A 11: 57,769,538 D267E probably damaging Het
Galr2 C T 11: 116,283,167 R208C probably damaging Het
Hif3a G A 7: 17,054,787 R82C unknown Het
Hspg2 T A 4: 137,511,966 F401L possibly damaging Het
Iars G T 13: 49,706,738 W455L probably damaging Het
Irf1 C T 11: 53,776,336 H294Y probably benign Het
Itgal T C 7: 127,330,184 L1091P probably damaging Het
Lrrc37a T G 11: 103,498,437 D2054A probably benign Het
Map3k2 T A 18: 32,220,594 H472Q probably benign Het
Myo18b T C 5: 112,692,292 D2545G probably damaging Het
Nle1 G T 11: 82,904,966 Y218* probably null Het
Pdlim5 A T 3: 142,277,862 S377T probably benign Het
Plch1 A T 3: 63,755,305 M259K probably benign Het
Pou6f1 A G 15: 100,584,098 V268A probably benign Het
Prn C A 2: 131,946,445 L7I unknown Het
Rarres1 A T 3: 67,491,012 F138L probably benign Het
Ros1 C T 10: 52,142,283 V781M probably damaging Het
Sec16a C A 2: 26,415,633 probably null Het
Slc44a4 G A 17: 34,928,700 G606D probably damaging Het
Slco1a4 A T 6: 141,810,511 C538* probably null Het
Slco1c1 A G 6: 141,567,610 Y537C probably benign Het
Speg T A 1: 75,429,161 L3003Q probably damaging Het
Ssr3 A G 3: 65,392,465 S25P probably benign Het
Stard13 C A 5: 151,060,802 R623L probably damaging Het
Tbc1d5 A G 17: 50,874,577 I376T probably damaging Het
Tigd4 C A 3: 84,594,917 F380L possibly damaging Het
Tmc4 T C 7: 3,669,575 K489E probably damaging Het
Tmem114 C T 16: 8,424,489 R55H probably benign Het
Tmem168 A G 6: 13,602,938 I143T probably benign Het
Tmem87b C T 2: 128,841,317 T397I probably damaging Het
Tom1l1 C A 11: 90,672,915 R173L probably benign Het
Trim10 G A 17: 36,871,752 R170K probably damaging Het
Usp6nl T A 2: 6,424,323 Y222N probably damaging Het
Vmn2r26 A T 6: 124,061,535 I690F possibly damaging Het
Other mutations in Prpf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Prpf6 APN 2 181631511 missense probably benign
IGL01729:Prpf6 APN 2 181654917 missense probably damaging 1.00
IGL02077:Prpf6 APN 2 181640664 missense probably damaging 1.00
IGL02187:Prpf6 APN 2 181616016 missense probably damaging 1.00
IGL02452:Prpf6 APN 2 181649085 missense probably benign 0.00
IGL02881:Prpf6 APN 2 181632071 missense probably benign 0.21
IGL03220:Prpf6 APN 2 181632879 missense probably damaging 1.00
IGL02837:Prpf6 UTSW 2 181622263 missense probably damaging 1.00
R0069:Prpf6 UTSW 2 181615963 splice site probably null
R0189:Prpf6 UTSW 2 181655457 missense probably benign 0.00
R0479:Prpf6 UTSW 2 181651127 missense probably benign 0.18
R0532:Prpf6 UTSW 2 181622211 missense possibly damaging 0.71
R0628:Prpf6 UTSW 2 181636048 missense probably damaging 0.96
R0674:Prpf6 UTSW 2 181631974 missense probably benign 0.05
R1863:Prpf6 UTSW 2 181608174 missense possibly damaging 0.81
R1954:Prpf6 UTSW 2 181632077 missense probably benign
R1955:Prpf6 UTSW 2 181632077 missense probably benign
R4612:Prpf6 UTSW 2 181632079 missense possibly damaging 0.81
R4627:Prpf6 UTSW 2 181601474 missense probably damaging 0.96
R5033:Prpf6 UTSW 2 181650106 missense possibly damaging 0.69
R5053:Prpf6 UTSW 2 181649453 missense probably benign 0.00
R5121:Prpf6 UTSW 2 181636043 missense probably benign
R5181:Prpf6 UTSW 2 181649546 missense probably damaging 0.98
R5380:Prpf6 UTSW 2 181608266 missense probably damaging 1.00
R5490:Prpf6 UTSW 2 181608165 missense probably benign 0.01
R5638:Prpf6 UTSW 2 181645588 missense probably benign 0.32
R5680:Prpf6 UTSW 2 181649140 missense probably damaging 0.99
R6152:Prpf6 UTSW 2 181621787 missense probably damaging 1.00
R6252:Prpf6 UTSW 2 181647363 missense probably damaging 1.00
R6317:Prpf6 UTSW 2 181631436 missense probably benign 0.06
R6501:Prpf6 UTSW 2 181621920 nonsense probably null
R6789:Prpf6 UTSW 2 181616051 nonsense probably null
R7023:Prpf6 UTSW 2 181620640 missense probably damaging 1.00
R7043:Prpf6 UTSW 2 181649504 missense probably benign
R7214:Prpf6 UTSW 2 181640596 missense probably damaging 1.00
R7538:Prpf6 UTSW 2 181652455 missense probably benign 0.16
R8020:Prpf6 UTSW 2 181645570 missense probably benign 0.05
R8345:Prpf6 UTSW 2 181650158 missense probably benign
R8786:Prpf6 UTSW 2 181620622 missense possibly damaging 0.77
R9151:Prpf6 UTSW 2 181608208 missense possibly damaging 0.70
R9623:Prpf6 UTSW 2 181647344 missense possibly damaging 0.62
RF016:Prpf6 UTSW 2 181632076 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGAAGTGTGAGAAGTGATGTTAC -3'
(R):5'- ACAGGCCGTACATTCGTGTG -3'

Sequencing Primer
(F):5'- AGTGTGAGAAGTGATGTTACTAAATG -3'
(R):5'- GTACATTCGTGTGCACCCCG -3'
Posted On 2019-11-12