Incidental Mutation 'R7696:Bglap2'
ID593648
Institutional Source Beutler Lab
Gene Symbol Bglap2
Ensembl Gene ENSMUSG00000074486
Gene Namebone gamma-carboxyglutamate protein 2
SynonymsmOC-B, OG2, bone Gla protein, osteocalcin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R7696 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88377736-88378699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88378616 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 12 (L12Q)
Ref Sequence ENSEMBL: ENSMUSP00000096555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076048] [ENSMUST00000098956]
Predicted Effect probably benign
Transcript: ENSMUST00000076048
SMART Domains Protein: ENSMUSP00000075425
Gene: ENSMUSG00000074483

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000098956
AA Change: L12Q
SMART Domains Protein: ENSMUSP00000096555
Gene: ENSMUSG00000074486
AA Change: L12Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a hormone that is secreted by osteoblasts and may function in bone remodeling and energy metabolism. Homozygous knockout mice for this gene exhibit a gradual increase in bone size, density and strength, as well as elevated adiposity and impaired glucose tolerance. This gene is present in a gene cluster with other related genes on chromosome 3. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of both Bglap1 and Bglap2 exhibit decreased circulating insulin, impaired glucose tolerance, increased adipose tissue, increased bone density, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A G 8: 129,219,313 Y344H probably benign Het
Adamts12 C T 15: 11,258,138 R512C probably damaging Het
Afap1l2 C A 19: 56,914,486 V754L probably damaging Het
Atp5a1 T A 18: 77,780,986 I393N probably damaging Het
Bbs1 C T 19: 4,890,989 probably null Het
Bsn C T 9: 108,114,501 V1351I probably damaging Het
Cbx1 T C 11: 96,806,642 V147A probably damaging Het
Cep192 T A 18: 67,820,363 S484T probably damaging Het
Col18a1 A T 10: 77,085,272 I298K unknown Het
Cyp27a1 A T 1: 74,732,039 I128L probably benign Het
Dhdds C T 4: 133,996,914 A30T probably damaging Het
Dnajc12 A G 10: 63,407,132 N143S probably benign Het
Eno3 T G 11: 70,661,983 N363K probably benign Het
Galnt10 T A 11: 57,769,538 D267E probably damaging Het
Galr2 C T 11: 116,283,167 R208C probably damaging Het
Hif3a G A 7: 17,054,787 R82C unknown Het
Hspg2 T A 4: 137,511,966 F401L possibly damaging Het
Iars G T 13: 49,706,738 W455L probably damaging Het
Irf1 C T 11: 53,776,336 H294Y probably benign Het
Itgal T C 7: 127,330,184 L1091P probably damaging Het
Lrrc37a T G 11: 103,498,437 D2054A probably benign Het
Map3k2 T A 18: 32,220,594 H472Q probably benign Het
Myo18b T C 5: 112,692,292 D2545G probably damaging Het
Nle1 G T 11: 82,904,966 Y218* probably null Het
Pdlim5 A T 3: 142,277,862 S377T probably benign Het
Plch1 A T 3: 63,755,305 M259K probably benign Het
Pou6f1 A G 15: 100,584,098 V268A probably benign Het
Prn C A 2: 131,946,445 L7I unknown Het
Prpf6 C T 2: 181,608,242 A65V possibly damaging Het
Rarres1 A T 3: 67,491,012 F138L probably benign Het
Ros1 C T 10: 52,142,283 V781M probably damaging Het
Sec16a C A 2: 26,415,633 probably null Het
Slc44a4 G A 17: 34,928,700 G606D probably damaging Het
Slco1a4 A T 6: 141,810,511 C538* probably null Het
Slco1c1 A G 6: 141,567,610 Y537C probably benign Het
Speg T A 1: 75,429,161 L3003Q probably damaging Het
Ssr3 A G 3: 65,392,465 S25P probably benign Het
Stard13 C A 5: 151,060,802 R623L probably damaging Het
Tbc1d5 A G 17: 50,874,577 I376T probably damaging Het
Tigd4 C A 3: 84,594,917 F380L possibly damaging Het
Tmc4 T C 7: 3,669,575 K489E probably damaging Het
Tmem114 C T 16: 8,424,489 R55H probably benign Het
Tmem168 A G 6: 13,602,938 I143T probably benign Het
Tmem87b C T 2: 128,841,317 T397I probably damaging Het
Tom1l1 C A 11: 90,672,915 R173L probably benign Het
Trim10 G A 17: 36,871,752 R170K probably damaging Het
Usp6nl T A 2: 6,424,323 Y222N probably damaging Het
Vmn2r26 A T 6: 124,061,535 I690F possibly damaging Het
Other mutations in Bglap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02494:Bglap2 APN 3 88377936 nonsense probably null
IGL02739:Bglap2 APN 3 88378012 splice site probably null
R0402:Bglap2 UTSW 3 88378245 missense probably damaging 1.00
R0694:Bglap2 UTSW 3 88378416 missense possibly damaging 0.64
R1846:Bglap2 UTSW 3 88378625 unclassified probably benign
R5114:Bglap2 UTSW 3 88382125 unclassified probably benign
R7331:Bglap2 UTSW 3 88378260 missense possibly damaging 0.94
R7677:Bglap2 UTSW 3 88377973 missense probably damaging 1.00
R7845:Bglap2 UTSW 3 88378694 start gained probably benign
R7928:Bglap2 UTSW 3 88378694 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCTTGGCATCTGTAAAG -3'
(R):5'- CACAGCATCCTTTGGGTTTGAC -3'

Sequencing Primer
(F):5'- GCTTGGCATCTGTAAAGCAAAC -3'
(R):5'- GTTTGACCCACTGAGCACATG -3'
Posted On2019-11-12