Incidental Mutation 'R7696:Vmn2r26'
ID 593655
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7696 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124038494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 690 (I690F)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect possibly damaging
Transcript: ENSMUST00000032238
AA Change: I690F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: I690F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 C T 15: 11,258,224 (GRCm39) R512C probably damaging Het
Afap1l2 C A 19: 56,902,918 (GRCm39) V754L probably damaging Het
Atp5f1a T A 18: 77,868,686 (GRCm39) I393N probably damaging Het
Bbs1 C T 19: 4,941,017 (GRCm39) probably null Het
Bglap2 A T 3: 88,285,923 (GRCm39) L12Q unknown Het
Bsn C T 9: 107,991,700 (GRCm39) V1351I probably damaging Het
Cbx1 T C 11: 96,697,468 (GRCm39) V147A probably damaging Het
Cep192 T A 18: 67,953,434 (GRCm39) S484T probably damaging Het
Col18a1 A T 10: 76,921,106 (GRCm39) I298K unknown Het
Cyp27a1 A T 1: 74,771,198 (GRCm39) I128L probably benign Het
Dhdds C T 4: 133,724,225 (GRCm39) A30T probably damaging Het
Dnajc12 A G 10: 63,242,911 (GRCm39) N143S probably benign Het
Eno3 T G 11: 70,552,809 (GRCm39) N363K probably benign Het
Galnt10 T A 11: 57,660,364 (GRCm39) D267E probably damaging Het
Galr2 C T 11: 116,173,993 (GRCm39) R208C probably damaging Het
Hif3a G A 7: 16,788,712 (GRCm39) R82C unknown Het
Hspg2 T A 4: 137,239,277 (GRCm39) F401L possibly damaging Het
Iars1 G T 13: 49,860,214 (GRCm39) W455L probably damaging Het
Irf1 C T 11: 53,667,162 (GRCm39) H294Y probably benign Het
Itgal T C 7: 126,929,356 (GRCm39) L1091P probably damaging Het
Lrrc37a T G 11: 103,389,263 (GRCm39) D2054A probably benign Het
Map3k2 T A 18: 32,353,647 (GRCm39) H472Q probably benign Het
Myo18b T C 5: 112,840,158 (GRCm39) D2545G probably damaging Het
Nle1 G T 11: 82,795,792 (GRCm39) Y218* probably null Het
Pdlim5 A T 3: 141,983,623 (GRCm39) S377T probably benign Het
Plch1 A T 3: 63,662,726 (GRCm39) M259K probably benign Het
Pou6f1 A G 15: 100,481,979 (GRCm39) V268A probably benign Het
Prn C A 2: 131,788,365 (GRCm39) L7I unknown Het
Prpf6 C T 2: 181,250,035 (GRCm39) A65V possibly damaging Het
Rarres1 A T 3: 67,398,345 (GRCm39) F138L probably benign Het
Ros1 C T 10: 52,018,379 (GRCm39) V781M probably damaging Het
Sec16a C A 2: 26,305,645 (GRCm39) probably null Het
Slc44a4 G A 17: 35,147,676 (GRCm39) G606D probably damaging Het
Slco1a4 A T 6: 141,756,237 (GRCm39) C538* probably null Het
Slco1c1 A G 6: 141,513,336 (GRCm39) Y537C probably benign Het
Speg T A 1: 75,405,805 (GRCm39) L3003Q probably damaging Het
Ssr3 A G 3: 65,299,886 (GRCm39) S25P probably benign Het
Stard13 C A 5: 150,984,267 (GRCm39) R623L probably damaging Het
Tbc1d5 A G 17: 51,181,605 (GRCm39) I376T probably damaging Het
Tigd4 C A 3: 84,502,224 (GRCm39) F380L possibly damaging Het
Tmc4 T C 7: 3,672,574 (GRCm39) K489E probably damaging Het
Tmem114 C T 16: 8,242,353 (GRCm39) R55H probably benign Het
Tmem168 A G 6: 13,602,937 (GRCm39) I143T probably benign Het
Tmem87b C T 2: 128,683,237 (GRCm39) T397I probably damaging Het
Tom1l1 C A 11: 90,563,741 (GRCm39) R173L probably benign Het
Trim10 G A 17: 37,182,644 (GRCm39) R170K probably damaging Het
Usp6nl T A 2: 6,429,134 (GRCm39) Y222N probably damaging Het
Zfp1006 A G 8: 129,945,794 (GRCm39) Y344H probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTGCTATCGAGAAACACCC -3'
(R):5'- CCCCTCGTTACACCAGAGAATG -3'

Sequencing Primer
(F):5'- TGCTATCGAGAAACACCCATTGTC -3'
(R):5'- CCCTCGTTACACCAGAGAATGATTTG -3'
Posted On 2019-11-12