Incidental Mutation 'R7696:Lrrc37a'
ID593672
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7696 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103498437 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 2054 (D2054A)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: D2054A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: D2054A

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A G 8: 129,219,313 Y344H probably benign Het
Adamts12 C T 15: 11,258,138 R512C probably damaging Het
Afap1l2 C A 19: 56,914,486 V754L probably damaging Het
Atp5a1 T A 18: 77,780,986 I393N probably damaging Het
Bbs1 C T 19: 4,890,989 probably null Het
Bglap2 A T 3: 88,378,616 L12Q unknown Het
Bsn C T 9: 108,114,501 V1351I probably damaging Het
Cbx1 T C 11: 96,806,642 V147A probably damaging Het
Cep192 T A 18: 67,820,363 S484T probably damaging Het
Col18a1 A T 10: 77,085,272 I298K unknown Het
Cyp27a1 A T 1: 74,732,039 I128L probably benign Het
Dhdds C T 4: 133,996,914 A30T probably damaging Het
Dnajc12 A G 10: 63,407,132 N143S probably benign Het
Eno3 T G 11: 70,661,983 N363K probably benign Het
Galnt10 T A 11: 57,769,538 D267E probably damaging Het
Galr2 C T 11: 116,283,167 R208C probably damaging Het
Hif3a G A 7: 17,054,787 R82C unknown Het
Hspg2 T A 4: 137,511,966 F401L possibly damaging Het
Iars G T 13: 49,706,738 W455L probably damaging Het
Irf1 C T 11: 53,776,336 H294Y probably benign Het
Itgal T C 7: 127,330,184 L1091P probably damaging Het
Map3k2 T A 18: 32,220,594 H472Q probably benign Het
Myo18b T C 5: 112,692,292 D2545G probably damaging Het
Nle1 G T 11: 82,904,966 Y218* probably null Het
Pdlim5 A T 3: 142,277,862 S377T probably benign Het
Plch1 A T 3: 63,755,305 M259K probably benign Het
Pou6f1 A G 15: 100,584,098 V268A probably benign Het
Prn C A 2: 131,946,445 L7I unknown Het
Prpf6 C T 2: 181,608,242 A65V possibly damaging Het
Rarres1 A T 3: 67,491,012 F138L probably benign Het
Ros1 C T 10: 52,142,283 V781M probably damaging Het
Sec16a C A 2: 26,415,633 probably null Het
Slc44a4 G A 17: 34,928,700 G606D probably damaging Het
Slco1a4 A T 6: 141,810,511 C538* probably null Het
Slco1c1 A G 6: 141,567,610 Y537C probably benign Het
Speg T A 1: 75,429,161 L3003Q probably damaging Het
Ssr3 A G 3: 65,392,465 S25P probably benign Het
Stard13 C A 5: 151,060,802 R623L probably damaging Het
Tbc1d5 A G 17: 50,874,577 I376T probably damaging Het
Tigd4 C A 3: 84,594,917 F380L possibly damaging Het
Tmc4 T C 7: 3,669,575 K489E probably damaging Het
Tmem114 C T 16: 8,424,489 R55H probably benign Het
Tmem168 A G 6: 13,602,938 I143T probably benign Het
Tmem87b C T 2: 128,841,317 T397I probably damaging Het
Tom1l1 C A 11: 90,672,915 R173L probably benign Het
Trim10 G A 17: 36,871,752 R170K probably damaging Het
Usp6nl T A 2: 6,424,323 Y222N probably damaging Het
Vmn2r26 A T 6: 124,061,535 I690F possibly damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103499638 missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103498236 missense unknown
R7694:Lrrc37a UTSW 11 103504378 missense probably benign 0.12
R7717:Lrrc37a UTSW 11 103504300 missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103497459 missense unknown
R7841:Lrrc37a UTSW 11 103501105 missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103503042 missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103501481 missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103457961 missense unknown
R8051:Lrrc37a UTSW 11 103503126 missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103457422 missense unknown
R8097:Lrrc37a UTSW 11 103504099 missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103503057 missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103497898 missense unknown
R8311:Lrrc37a UTSW 11 103503421 missense probably benign 0.05
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103456486 missense probably damaging 1.00
Z1176:Lrrc37a UTSW 11 103499034 missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103501094 missense probably benign 0.09
Z1177:Lrrc37a UTSW 11 103499967 missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103500520 missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103500598 missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103503027 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATGCTGAGATTGACCATGAGC -3'
(R):5'- GTTACAGCAAAAGCTCCCATG -3'

Sequencing Primer
(F):5'- CTGAGATTGACCATGAGCAATCATG -3'
(R):5'- CAGCAAAAGCTCCCATGTTTTATG -3'
Posted On2019-11-12