Incidental Mutation 'R7697:Ildr2'
ID593689
Institutional Source Beutler Lab
Gene Symbol Ildr2
Ensembl Gene ENSMUSG00000040612
Gene Nameimmunoglobulin-like domain containing receptor 2
SynonymsD1Ertd471e, ENSMUSG00000040612, 2810478N18Rik, 3110063L10Rik, OTTMUSG00000021748, Dbsm1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location166254139-166316823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 166294731 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 248 (Q248K)
Ref Sequence ENSEMBL: ENSMUSP00000107047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111416] [ENSMUST00000192426] [ENSMUST00000192638] [ENSMUST00000192732] [ENSMUST00000193860] [ENSMUST00000194964] [ENSMUST00000195557]
Predicted Effect probably benign
Transcript: ENSMUST00000111416
AA Change: Q248K

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107047
Gene: ENSMUSG00000040612
AA Change: Q248K

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
IG 42 181 4.6e-3 SMART
Pfam:LSR 201 248 2e-26 PFAM
low complexity region 260 278 N/A INTRINSIC
low complexity region 512 527 N/A INTRINSIC
low complexity region 591 607 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192426
SMART Domains Protein: ENSMUSP00000141961
Gene: ENSMUSG00000040612

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192638
AA Change: Q229K

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142311
Gene: ENSMUSG00000040612
AA Change: Q229K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Pfam:LSR 182 230 2e-23 PFAM
low complexity region 241 259 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192732
SMART Domains Protein: ENSMUSP00000141502
Gene: ENSMUSG00000040612

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
low complexity region 385 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193860
SMART Domains Protein: ENSMUSP00000141323
Gene: ENSMUSG00000040612

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
low complexity region 404 419 N/A INTRINSIC
low complexity region 483 499 N/A INTRINSIC
low complexity region 531 542 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194964
AA Change: Q248K
SMART Domains Protein: ENSMUSP00000142152
Gene: ENSMUSG00000040612
AA Change: Q248K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Pfam:LSR 201 249 1.9e-23 PFAM
low complexity region 453 468 N/A INTRINSIC
low complexity region 532 548 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195557
AA Change: Q248K

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142240
Gene: ENSMUSG00000040612
AA Change: Q248K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
IG 42 181 1.9e-5 SMART
IG_like 121 167 2.9e-2 SMART
Pfam:LSR 201 249 1.2e-23 PFAM
low complexity region 260 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced stop mutation at threonine-87 display a reduced pancreatic beta-cell replication rate, decreased beta-cell mass, reduced insulin/glucose ratio in blood, impaired glucose tolerance, and persistent mild hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Ildr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Ildr2 APN 1 166269370 missense possibly damaging 0.76
R0079:Ildr2 UTSW 1 166307720 missense probably damaging 1.00
R0371:Ildr2 UTSW 1 166303564 missense probably damaging 1.00
R0426:Ildr2 UTSW 1 166308899 missense probably benign 0.00
R1528:Ildr2 UTSW 1 166270495 splice site probably null
R1570:Ildr2 UTSW 1 166303585 missense probably damaging 1.00
R2143:Ildr2 UTSW 1 166269326 missense probably damaging 1.00
R2760:Ildr2 UTSW 1 166303606 missense probably damaging 1.00
R3960:Ildr2 UTSW 1 166309340 missense probably damaging 0.99
R4965:Ildr2 UTSW 1 166307840 missense probably damaging 1.00
R5101:Ildr2 UTSW 1 166307762 missense probably damaging 1.00
R5351:Ildr2 UTSW 1 166308909 missense possibly damaging 0.58
R6021:Ildr2 UTSW 1 166303604 missense possibly damaging 0.77
R6841:Ildr2 UTSW 1 166270575 missense probably damaging 1.00
R7028:Ildr2 UTSW 1 166303529 missense probably damaging 1.00
R7117:Ildr2 UTSW 1 166295811 missense probably damaging 1.00
R7169:Ildr2 UTSW 1 166307934 critical splice donor site probably null
R7344:Ildr2 UTSW 1 166294597 missense probably damaging 1.00
R7612:Ildr2 UTSW 1 166307792 missense probably benign 0.43
R7869:Ildr2 UTSW 1 166309292 missense probably benign 0.01
R7908:Ildr2 UTSW 1 166307800 missense probably damaging 1.00
X0009:Ildr2 UTSW 1 166269311 missense probably benign 0.05
Z1177:Ildr2 UTSW 1 166309049 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGATGCCGTGTCCTGAAAG -3'
(R):5'- AGGAATGCATGACACGCGTG -3'

Sequencing Primer
(F):5'- TGTCCTGAAAGGGGGCTAC -3'
(R):5'- TGACACGCGTGGATAAACC -3'
Posted On2019-11-12