Incidental Mutation 'R0240:Plce1'
ID 59369
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Name phospholipase C, epsilon 1
Synonyms PLCepsilon, 4933403A21Rik
MMRRC Submission 038478-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R0240 (G1)
Quality Score 184
Status Validated
Chromosome 19
Chromosomal Location 38469557-38773474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 38717330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 1373 (K1373T)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
AlphaFold Q8K4S1
Predicted Effect probably damaging
Transcript: ENSMUST00000169713
AA Change: K1373T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: K1373T

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182267
AA Change: K1373T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: K1373T

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182481
AA Change: K1373T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: K1373T

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182589
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 123,506,920 (GRCm39) L71P probably damaging Het
Adamts2 A T 11: 50,666,201 (GRCm39) D399V probably damaging Het
Adck2 T A 6: 39,560,752 (GRCm39) V380E probably benign Het
Alg11 T A 8: 22,555,468 (GRCm39) V243D possibly damaging Het
Ankrd27 T A 7: 35,318,864 (GRCm39) L585Q probably damaging Het
Armh4 A G 14: 50,005,859 (GRCm39) probably benign Het
Atp7a T A X: 105,153,447 (GRCm39) N1117K probably damaging Het
Bltp3a T A 17: 28,114,844 (GRCm39) probably benign Het
Cacna1b G A 2: 24,528,669 (GRCm39) probably benign Het
Cacna1d T A 14: 29,818,926 (GRCm39) M1210L probably benign Het
Cacna1s T C 1: 136,001,234 (GRCm39) probably benign Het
Chd7 T C 4: 8,852,670 (GRCm39) probably benign Het
Col12a1 A T 9: 79,559,315 (GRCm39) S1858T probably benign Het
Cotl1 C T 8: 120,567,063 (GRCm39) W26* probably null Het
Csmd3 T C 15: 47,492,635 (GRCm39) T3000A probably benign Het
Dcp1a T A 14: 30,206,551 (GRCm39) probably benign Het
Ddhd2 A T 8: 26,229,617 (GRCm39) probably null Het
Dnah8 T C 17: 30,984,653 (GRCm39) I3117T probably damaging Het
Dnm3 G T 1: 162,181,194 (GRCm39) Q162K probably benign Het
Dpy19l2 G T 9: 24,569,876 (GRCm39) A359D probably damaging Het
Ece1 T A 4: 137,676,746 (GRCm39) probably benign Het
Eif4g3 A G 4: 137,897,873 (GRCm39) K1025R probably damaging Het
Eml2 C A 7: 18,918,797 (GRCm39) Y82* probably null Het
Eml6 A G 11: 29,742,367 (GRCm39) V1057A possibly damaging Het
Eral1 A G 11: 77,966,884 (GRCm39) probably benign Het
Espl1 T C 15: 102,220,976 (GRCm39) S911P probably benign Het
Fbxo8 A G 8: 57,043,296 (GRCm39) probably benign Het
Flrt1 A T 19: 7,074,475 (GRCm39) probably benign Het
Fndc7 A G 3: 108,766,235 (GRCm39) probably benign Het
G3bp1 G A 11: 55,382,854 (GRCm39) G139D probably damaging Het
Gabra6 C T 11: 42,205,774 (GRCm39) V351I probably benign Het
Galc A T 12: 98,218,293 (GRCm39) H186Q probably damaging Het
Ganab A G 19: 8,890,177 (GRCm39) D702G possibly damaging Het
Hdac10 T C 15: 89,010,085 (GRCm39) E291G possibly damaging Het
Hectd3 T G 4: 116,859,810 (GRCm39) V749G probably damaging Het
Kash5 C T 7: 44,849,675 (GRCm39) A83T probably benign Het
Kcnh1 T A 1: 192,187,648 (GRCm39) I703N probably benign Het
Kcnma1 G A 14: 23,544,647 (GRCm39) T505I probably damaging Het
Kctd11 A G 11: 69,770,640 (GRCm39) C133R probably damaging Het
Lama3 A T 18: 12,672,880 (GRCm39) probably null Het
Lamb3 T C 1: 193,017,335 (GRCm39) L842P probably damaging Het
Ldlr T C 9: 21,649,295 (GRCm39) probably benign Het
Lipk G A 19: 34,024,210 (GRCm39) R336H probably benign Het
Lrrc24 T A 15: 76,607,409 (GRCm39) D58V probably damaging Het
Lrsam1 A G 2: 32,845,197 (GRCm39) L106P probably damaging Het
Milr1 G A 11: 106,645,722 (GRCm39) W88* probably null Het
Mmp10 A G 9: 7,506,544 (GRCm39) D340G probably damaging Het
Mybpc1 T A 10: 88,391,600 (GRCm39) Y285F possibly damaging Het
Ncoa3 A G 2: 165,896,320 (GRCm39) T408A probably benign Het
Nefm T A 14: 68,358,583 (GRCm39) K484* probably null Het
Nfasc A G 1: 132,529,721 (GRCm39) S814P probably damaging Het
Nlrp4a T C 7: 26,161,941 (GRCm39) V863A probably benign Het
Nos1 C T 5: 118,005,948 (GRCm39) P223S probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Or13c7 T A 4: 43,854,512 (GRCm39) S68T probably damaging Het
Or4c108 A T 2: 88,803,740 (GRCm39) L165Q probably damaging Het
Or5an6 A T 19: 12,372,327 (GRCm39) E233D probably benign Het
Or8k41 A G 2: 86,313,730 (GRCm39) S119P possibly damaging Het
Osbpl5 T C 7: 143,295,406 (GRCm39) probably null Het
Otog C A 7: 45,913,456 (GRCm39) probably null Het
Pacs1 A T 19: 5,206,402 (GRCm39) I261N possibly damaging Het
Pbx1 G A 1: 168,031,051 (GRCm39) T189I possibly damaging Het
Pcnx1 T C 12: 81,993,792 (GRCm39) I908T possibly damaging Het
Pdxdc1 A T 16: 13,697,309 (GRCm39) W124R probably damaging Het
Phex C A X: 155,969,214 (GRCm39) D587Y probably damaging Het
Plcb3 A T 19: 6,940,363 (GRCm39) D435E probably benign Het
Prkcd G A 14: 30,324,045 (GRCm39) A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 (GRCm39) S421T probably benign Het
Ptprs T C 17: 56,743,087 (GRCm39) probably null Het
Qrich1 A G 9: 108,411,333 (GRCm39) D286G probably damaging Het
Rcc1 C A 4: 132,060,226 (GRCm39) G393V probably damaging Het
Reln T C 5: 22,311,043 (GRCm39) N290S probably benign Het
Rgl1 T C 1: 152,430,175 (GRCm39) probably benign Het
Rhpn1 C T 15: 75,585,971 (GRCm39) T628I probably benign Het
Rilp A G 11: 75,401,747 (GRCm39) R176G probably benign Het
Riok3 C T 18: 12,288,284 (GRCm39) A487V probably benign Het
Rnf224 T C 2: 25,126,219 (GRCm39) T45A probably damaging Het
Rpa1 A G 11: 75,219,513 (GRCm39) V137A probably benign Het
Rps6ka1 C A 4: 133,575,842 (GRCm39) Q693H probably benign Het
Scn2a G T 2: 65,566,118 (GRCm39) V1381F probably benign Het
Scp2 T A 4: 107,955,275 (GRCm39) H112L probably benign Het
Sdk1 T C 5: 141,984,502 (GRCm39) W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 (GRCm39) V408F probably damaging Het
Slc28a2 T A 2: 122,285,008 (GRCm39) I332N probably benign Het
Slc37a3 A G 6: 39,314,172 (GRCm39) V480A probably benign Het
Slc45a4 T A 15: 73,453,755 (GRCm39) E674D probably benign Het
Smpd3 T C 8: 106,991,788 (GRCm39) E255G probably damaging Het
Snx29 C T 16: 11,478,417 (GRCm39) R658W probably damaging Het
Sppl2a A T 2: 126,762,256 (GRCm39) M275K probably benign Het
Stac T C 9: 111,464,089 (GRCm39) N59S probably damaging Het
Stk25 A T 1: 93,554,782 (GRCm39) L131Q probably damaging Het
Tep1 C T 14: 51,100,486 (GRCm39) probably benign Het
Thbs1 C A 2: 117,944,874 (GRCm39) N229K probably damaging Het
Tmx2 A T 2: 84,506,186 (GRCm39) H89Q probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tradd T C 8: 105,985,924 (GRCm39) N209S possibly damaging Het
Trappc3l A T 10: 33,974,928 (GRCm39) R119* probably null Het
Trmt1l G A 1: 151,333,205 (GRCm39) probably benign Het
Ublcp1 G T 11: 44,349,104 (GRCm39) Y243* probably null Het
Usp24 C A 4: 106,271,601 (GRCm39) C2158* probably null Het
Usp34 A T 11: 23,383,206 (GRCm39) K2088N probably damaging Het
Vmn1r53 G C 6: 90,200,925 (GRCm39) S133C probably damaging Het
Vmn2r52 A G 7: 9,893,327 (GRCm39) V604A probably damaging Het
Vmn2r93 A G 17: 18,525,061 (GRCm39) K240E probably benign Het
Wdr13 T G X: 7,994,284 (GRCm39) D242A probably damaging Het
Wwp1 C T 4: 19,641,734 (GRCm39) probably null Het
Zan G A 5: 137,396,624 (GRCm39) H4311Y unknown Het
Zc3h12c C A 9: 52,055,383 (GRCm39) R123L possibly damaging Het
Zfp125 A T 12: 20,950,562 (GRCm39) noncoding transcript Het
Zfp318 C T 17: 46,707,739 (GRCm39) P266S probably benign Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38,734,232 (GRCm39) missense probably damaging 0.99
IGL00336:Plce1 APN 19 38,640,350 (GRCm39) missense probably damaging 1.00
IGL00430:Plce1 APN 19 38,713,461 (GRCm39) missense probably damaging 1.00
IGL00466:Plce1 APN 19 38,709,473 (GRCm39) missense probably damaging 0.99
IGL00477:Plce1 APN 19 38,513,576 (GRCm39) missense probably benign 0.39
IGL00839:Plce1 APN 19 38,687,006 (GRCm39) missense probably damaging 1.00
IGL01292:Plce1 APN 19 38,640,229 (GRCm39) splice site probably benign
IGL01665:Plce1 APN 19 38,513,331 (GRCm39) missense probably benign 0.01
IGL01826:Plce1 APN 19 38,727,682 (GRCm39) splice site probably benign
IGL01833:Plce1 APN 19 38,709,425 (GRCm39) missense probably damaging 1.00
IGL02201:Plce1 APN 19 38,757,890 (GRCm39) splice site probably benign
IGL02276:Plce1 APN 19 38,513,201 (GRCm39) missense probably benign 0.05
IGL02477:Plce1 APN 19 38,707,997 (GRCm39) splice site probably benign
IGL02746:Plce1 APN 19 38,686,916 (GRCm39) missense probably damaging 1.00
Angel_food UTSW 19 38,715,457 (GRCm39) splice site probably benign
Heavenly UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38,769,228 (GRCm39) critical splice donor site probably null
R0116:Plce1 UTSW 19 38,710,265 (GRCm39) missense probably benign
R0138:Plce1 UTSW 19 38,512,863 (GRCm39) missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0504:Plce1 UTSW 19 38,766,465 (GRCm39) splice site probably benign
R0506:Plce1 UTSW 19 38,748,582 (GRCm39) missense probably benign 0.04
R0578:Plce1 UTSW 19 38,766,383 (GRCm39) missense probably damaging 1.00
R0645:Plce1 UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0730:Plce1 UTSW 19 38,705,135 (GRCm39) missense probably damaging 0.98
R0920:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,755,670 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,690,457 (GRCm39) missense probably damaging 1.00
R1484:Plce1 UTSW 19 38,693,783 (GRCm39) nonsense probably null
R1488:Plce1 UTSW 19 38,705,247 (GRCm39) missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38,709,440 (GRCm39) missense probably damaging 1.00
R1624:Plce1 UTSW 19 38,713,219 (GRCm39) missense probably damaging 1.00
R1732:Plce1 UTSW 19 38,705,282 (GRCm39) missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38,769,234 (GRCm39) splice site probably benign
R1797:Plce1 UTSW 19 38,747,392 (GRCm39) critical splice donor site probably null
R1872:Plce1 UTSW 19 38,748,521 (GRCm39) missense probably damaging 1.00
R1876:Plce1 UTSW 19 38,769,067 (GRCm39) missense probably damaging 1.00
R1991:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2080:Plce1 UTSW 19 38,715,457 (GRCm39) splice site probably benign
R2103:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2376:Plce1 UTSW 19 38,766,430 (GRCm39) missense probably benign 0.02
R2471:Plce1 UTSW 19 38,768,370 (GRCm39) missense probably damaging 1.00
R2511:Plce1 UTSW 19 38,748,498 (GRCm39) missense probably damaging 1.00
R2842:Plce1 UTSW 19 38,512,727 (GRCm39) missense probably damaging 1.00
R3037:Plce1 UTSW 19 38,766,328 (GRCm39) missense probably damaging 0.98
R3104:Plce1 UTSW 19 38,608,963 (GRCm39) missense probably benign 0.00
R3700:Plce1 UTSW 19 38,693,781 (GRCm39) missense probably damaging 1.00
R3750:Plce1 UTSW 19 38,766,343 (GRCm39) missense probably benign
R3753:Plce1 UTSW 19 38,640,278 (GRCm39) missense probably benign 0.09
R4027:Plce1 UTSW 19 38,512,709 (GRCm39) missense probably damaging 1.00
R4057:Plce1 UTSW 19 38,748,563 (GRCm39) missense probably damaging 1.00
R4376:Plce1 UTSW 19 38,693,891 (GRCm39) critical splice donor site probably null
R4433:Plce1 UTSW 19 38,755,745 (GRCm39) missense probably damaging 1.00
R4520:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38,513,088 (GRCm39) missense probably benign 0.30
R4673:Plce1 UTSW 19 38,737,840 (GRCm39) missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38,713,451 (GRCm39) missense probably benign 0.33
R4828:Plce1 UTSW 19 38,757,943 (GRCm39) missense probably damaging 1.00
R5103:Plce1 UTSW 19 38,755,659 (GRCm39) missense probably damaging 1.00
R5112:Plce1 UTSW 19 38,640,277 (GRCm39) missense probably benign 0.00
R5236:Plce1 UTSW 19 38,758,791 (GRCm39) missense probably benign 0.11
R5268:Plce1 UTSW 19 38,747,279 (GRCm39) missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5384:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5386:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5448:Plce1 UTSW 19 38,768,361 (GRCm39) missense probably damaging 1.00
R5452:Plce1 UTSW 19 38,608,926 (GRCm39) missense probably benign 0.01
R6004:Plce1 UTSW 19 38,710,315 (GRCm39) missense probably damaging 1.00
R6062:Plce1 UTSW 19 38,513,195 (GRCm39) missense probably benign
R6147:Plce1 UTSW 19 38,690,481 (GRCm39) missense probably damaging 1.00
R6247:Plce1 UTSW 19 38,734,289 (GRCm39) missense probably damaging 1.00
R6278:Plce1 UTSW 19 38,713,495 (GRCm39) splice site probably null
R6306:Plce1 UTSW 19 38,757,909 (GRCm39) missense probably damaging 1.00
R6317:Plce1 UTSW 19 38,512,974 (GRCm39) nonsense probably null
R6437:Plce1 UTSW 19 38,513,576 (GRCm39) missense probably benign 0.39
R6522:Plce1 UTSW 19 38,736,965 (GRCm39) splice site probably null
R7034:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7036:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7037:Plce1 UTSW 19 38,690,461 (GRCm39) missense probably damaging 1.00
R7069:Plce1 UTSW 19 38,747,384 (GRCm39) missense probably damaging 1.00
R7180:Plce1 UTSW 19 38,768,229 (GRCm39) missense probably damaging 1.00
R7189:Plce1 UTSW 19 38,748,581 (GRCm39) missense probably damaging 0.97
R7227:Plce1 UTSW 19 38,715,346 (GRCm39) missense probably benign 0.00
R7253:Plce1 UTSW 19 38,686,952 (GRCm39) missense probably damaging 1.00
R7278:Plce1 UTSW 19 38,768,340 (GRCm39) missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38,690,347 (GRCm39) missense probably benign 0.02
R7422:Plce1 UTSW 19 38,640,329 (GRCm39) missense probably damaging 1.00
R7557:Plce1 UTSW 19 38,753,848 (GRCm39) missense probably benign 0.30
R7607:Plce1 UTSW 19 38,513,196 (GRCm39) missense probably benign
R7615:Plce1 UTSW 19 38,513,109 (GRCm39) missense probably benign 0.18
R7653:Plce1 UTSW 19 38,737,763 (GRCm39) missense probably benign 0.20
R7685:Plce1 UTSW 19 38,736,877 (GRCm39) missense probably benign 0.00
R7716:Plce1 UTSW 19 38,705,295 (GRCm39) missense probably benign
R7744:Plce1 UTSW 19 38,608,899 (GRCm39) missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38,769,140 (GRCm39) missense probably damaging 0.97
R7921:Plce1 UTSW 19 38,608,997 (GRCm39) missense probably benign 0.03
R8070:Plce1 UTSW 19 38,690,283 (GRCm39) missense probably damaging 0.99
R8087:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R8116:Plce1 UTSW 19 38,513,262 (GRCm39) missense probably benign 0.32
R8178:Plce1 UTSW 19 38,761,423 (GRCm39) missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38,640,380 (GRCm39) missense probably benign 0.00
R8416:Plce1 UTSW 19 38,761,441 (GRCm39) missense possibly damaging 0.77
R8544:Plce1 UTSW 19 38,512,903 (GRCm39) missense probably benign 0.00
R8713:Plce1 UTSW 19 38,513,345 (GRCm39) missense probably benign 0.01
R8850:Plce1 UTSW 19 38,512,811 (GRCm39) missense probably benign
R9217:Plce1 UTSW 19 38,748,551 (GRCm39) missense probably damaging 1.00
R9231:Plce1 UTSW 19 38,705,040 (GRCm39) missense probably benign 0.13
R9232:Plce1 UTSW 19 38,705,423 (GRCm39) missense probably benign 0.16
R9332:Plce1 UTSW 19 38,726,377 (GRCm39) missense probably damaging 1.00
R9473:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9474:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9475:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9476:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9751:Plce1 UTSW 19 38,717,414 (GRCm39) missense probably damaging 1.00
R9780:Plce1 UTSW 19 38,609,134 (GRCm39) missense possibly damaging 0.94
R9781:Plce1 UTSW 19 38,513,654 (GRCm39) missense probably damaging 1.00
RF018:Plce1 UTSW 19 38,705,651 (GRCm39) missense probably damaging 0.99
X0022:Plce1 UTSW 19 38,715,443 (GRCm39) missense probably damaging 1.00
X0065:Plce1 UTSW 19 38,766,358 (GRCm39) missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38,757,904 (GRCm39) missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38,713,424 (GRCm39) nonsense probably null
Z1176:Plce1 UTSW 19 38,690,338 (GRCm39) missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38,640,286 (GRCm39) missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- AGCGTCAGCATGTGTCATCAAGG -3'
(R):5'- CTCTGCAAGAAAGCCGCATTTCC -3'

Sequencing Primer
(F):5'- GGCCTACTGTCATTTGAAGGG -3'
(R):5'- TCCGACTGAGATCTAAAAGCTG -3'
Posted On 2013-07-11