Incidental Mutation 'R7697:Acoxl'
ID593695
Institutional Source Beutler Lab
Gene Symbol Acoxl
Ensembl Gene ENSMUSG00000027380
Gene Nameacyl-Coenzyme A oxidase-like
Synonyms1200014P05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127838876-128123873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127978782 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 365 (T365A)
Ref Sequence ENSEMBL: ENSMUSP00000028859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028859] [ENSMUST00000110344]
Predicted Effect probably benign
Transcript: ENSMUST00000028859
AA Change: T365A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028859
Gene: ENSMUSG00000027380
AA Change: T365A

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 115 223 7.2e-19 PFAM
Pfam:Acyl-CoA_dh_1 254 416 1.8e-14 PFAM
Pfam:ACOX 458 599 6.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110344
AA Change: T85A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105973
Gene: ENSMUSG00000027380
AA Change: T85A

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_1 1 136 1.2e-9 PFAM
Pfam:ACOX 175 319 1.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Acoxl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Acoxl APN 2 127978804 missense probably damaging 1.00
IGL01397:Acoxl APN 2 128034891 missense possibly damaging 0.67
IGL02502:Acoxl APN 2 128075884 missense probably damaging 1.00
gulch UTSW 2 128123024 missense probably benign 0.02
Gully UTSW 2 128044391 missense possibly damaging 0.62
P4748:Acoxl UTSW 2 128086344 splice site probably benign
R0450:Acoxl UTSW 2 127880503 splice site probably null
R0469:Acoxl UTSW 2 127880503 splice site probably null
R0510:Acoxl UTSW 2 127880503 splice site probably null
R1257:Acoxl UTSW 2 128044366 missense probably benign 0.01
R1703:Acoxl UTSW 2 127978772 missense probably damaging 0.99
R1726:Acoxl UTSW 2 127880446 missense probably damaging 1.00
R1867:Acoxl UTSW 2 127877787 missense probably damaging 1.00
R2103:Acoxl UTSW 2 127972606 missense probably damaging 0.97
R2168:Acoxl UTSW 2 127878781 missense probably damaging 1.00
R2761:Acoxl UTSW 2 127877813 missense probably benign 0.01
R3895:Acoxl UTSW 2 127972525 splice site probably benign
R4370:Acoxl UTSW 2 127878788 missense possibly damaging 0.95
R4571:Acoxl UTSW 2 127877807 missense probably damaging 1.00
R4727:Acoxl UTSW 2 127978738 missense probably damaging 1.00
R4851:Acoxl UTSW 2 128044391 missense possibly damaging 0.62
R4962:Acoxl UTSW 2 128075890 missense probably damaging 0.98
R5248:Acoxl UTSW 2 128075935 critical splice donor site probably null
R5392:Acoxl UTSW 2 128010168 critical splice donor site probably null
R5411:Acoxl UTSW 2 127854901 missense probably benign 0.00
R5418:Acoxl UTSW 2 127877802 missense probably benign 0.34
R5507:Acoxl UTSW 2 127884474 missense probably damaging 0.99
R5681:Acoxl UTSW 2 127972639 missense possibly damaging 0.93
R5738:Acoxl UTSW 2 127877766 missense probably benign 0.21
R6325:Acoxl UTSW 2 128123024 missense probably benign 0.02
R6800:Acoxl UTSW 2 128010165 missense probably damaging 1.00
R7027:Acoxl UTSW 2 128010083 missense probably benign
R7098:Acoxl UTSW 2 127854915 nonsense probably null
R7165:Acoxl UTSW 2 128123108 missense probably benign
R7395:Acoxl UTSW 2 127884416 missense probably damaging 1.00
Z1088:Acoxl UTSW 2 127872195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGTTTTGTAGGGCATCCTG -3'
(R):5'- AAGTACCCAGAGGCAGTGAC -3'

Sequencing Primer
(F):5'- TGTAGGGCATCCTGAGTACTAAC -3'
(R):5'- GGCAGTGACAGTGTACTTAAGATTC -3'
Posted On2019-11-12