Incidental Mutation 'R7697:Flnc'
ID593706
Institutional Source Beutler Lab
Gene Symbol Flnc
Ensembl Gene ENSMUSG00000068699
Gene Namefilamin C, gamma
Synonyms1110055E19Rik, actin binding protein 280, Fln2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location29433256-29461883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29456517 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2238 (I2238N)
Ref Sequence ENSEMBL: ENSMUSP00000064163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065090] [ENSMUST00000101617]
Predicted Effect probably damaging
Transcript: ENSMUST00000065090
AA Change: I2238N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064163
Gene: ENSMUSG00000068699
AA Change: I2238N

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 1.05e-30 SMART
IG_FLMN 1777 1858 2.93e-11 SMART
IG_FLMN 1859 1950 2.55e-43 SMART
IG_FLMN 1951 2037 2.43e-17 SMART
IG_FLMN 2041 2132 1.52e-41 SMART
PDB:2E9I|A 2133 2162 3e-7 PDB
IG_FLMN 2217 2310 2.93e-11 SMART
IG_FLMN 2314 2405 1.67e-38 SMART
IG_FLMN 2408 2500 2.56e-25 SMART
IG_FLMN 2505 2596 9.54e-34 SMART
low complexity region 2618 2628 N/A INTRINSIC
IG_FLMN 2635 2737 2.11e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101617
AA Change: I2205N

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099139
Gene: ENSMUSG00000068699
AA Change: I2205N

DomainStartEndE-ValueType
CH 39 141 1.17e-25 SMART
CH 162 258 2.09e-22 SMART
IG_FLMN 275 372 3.84e-38 SMART
IG_FLMN 375 472 3.73e-36 SMART
IG_FLMN 474 569 4.41e-38 SMART
IG_FLMN 571 662 3.61e-34 SMART
IG_FLMN 667 762 2.48e-41 SMART
IG_FLMN 764 865 6.7e-29 SMART
IG_FLMN 867 964 3.42e-35 SMART
IG_FLMN 966 1060 2.92e-29 SMART
IG_FLMN 1062 1153 3.69e-40 SMART
IG_FLMN 1155 1248 6.53e-41 SMART
IG_FLMN 1250 1348 7.23e-34 SMART
IG_FLMN 1350 1441 2.04e-42 SMART
IG_FLMN 1443 1537 1.75e-41 SMART
IG_FLMN 1539 1634 1.31e-40 SMART
IG_FLMN 1636 1738 6.11e-32 SMART
IG_FLMN 1744 1825 2.93e-11 SMART
IG_FLMN 1826 1917 2.55e-43 SMART
IG_FLMN 1918 2004 2.43e-17 SMART
IG_FLMN 2008 2099 1.52e-41 SMART
PDB:2E9I|A 2100 2129 3e-7 PDB
IG_FLMN 2184 2277 2.93e-11 SMART
IG_FLMN 2281 2372 1.67e-38 SMART
IG_FLMN 2375 2467 2.56e-25 SMART
IG_FLMN 2472 2563 9.54e-34 SMART
low complexity region 2585 2595 N/A INTRINSIC
IG_FLMN 2602 2704 2.11e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display neonatal lethality, respiratory failure, reduced skeletal muscle mass, and abnormal skeletal muscle fiber morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Flnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Flnc APN 6 29459547 nonsense probably null
IGL01099:Flnc APN 6 29433618 missense probably damaging 0.99
IGL01656:Flnc APN 6 29443508 splice site probably benign
IGL01659:Flnc APN 6 29448671 missense probably damaging 0.98
IGL01780:Flnc APN 6 29438493 nonsense probably null
IGL01935:Flnc APN 6 29454280 missense probably damaging 1.00
IGL02039:Flnc APN 6 29450719 missense probably benign 0.05
IGL02119:Flnc APN 6 29447512 missense probably damaging 0.98
IGL02122:Flnc APN 6 29444336 missense possibly damaging 0.70
IGL02236:Flnc APN 6 29454376 missense probably damaging 1.00
IGL02350:Flnc APN 6 29438493 nonsense probably null
IGL02357:Flnc APN 6 29438493 nonsense probably null
IGL02428:Flnc APN 6 29451485 missense probably damaging 1.00
IGL02496:Flnc APN 6 29440685 missense probably damaging 0.98
IGL02516:Flnc APN 6 29450841 missense probably damaging 0.99
IGL02696:Flnc APN 6 29446698 missense probably damaging 0.98
IGL03165:Flnc APN 6 29449378 missense probably damaging 1.00
IGL03190:Flnc APN 6 29445637 splice site probably benign
I1329:Flnc UTSW 6 29451415 missense probably damaging 1.00
R0111:Flnc UTSW 6 29454340 missense probably damaging 0.99
R0665:Flnc UTSW 6 29455531 missense probably damaging 1.00
R0748:Flnc UTSW 6 29446344 missense probably damaging 0.99
R0960:Flnc UTSW 6 29441512 missense probably damaging 1.00
R1328:Flnc UTSW 6 29438613 missense probably damaging 1.00
R1502:Flnc UTSW 6 29438694 missense probably benign 0.45
R1544:Flnc UTSW 6 29444080 missense probably benign 0.00
R1565:Flnc UTSW 6 29455171 missense probably damaging 1.00
R1640:Flnc UTSW 6 29433807 missense possibly damaging 0.78
R1691:Flnc UTSW 6 29441214 missense probably benign 0.09
R1818:Flnc UTSW 6 29457448 missense probably damaging 1.00
R1826:Flnc UTSW 6 29455185 missense probably damaging 0.99
R1851:Flnc UTSW 6 29443479 missense probably damaging 1.00
R1898:Flnc UTSW 6 29438666 nonsense probably null
R1905:Flnc UTSW 6 29459460 missense probably damaging 1.00
R1985:Flnc UTSW 6 29444416 splice site probably benign
R2016:Flnc UTSW 6 29443797 critical splice donor site probably null
R2017:Flnc UTSW 6 29443797 critical splice donor site probably null
R2020:Flnc UTSW 6 29444363 missense probably damaging 0.97
R2104:Flnc UTSW 6 29450735 critical splice donor site probably null
R2132:Flnc UTSW 6 29443676 missense probably damaging 1.00
R2141:Flnc UTSW 6 29448675 missense probably damaging 1.00
R2197:Flnc UTSW 6 29459135 missense probably damaging 1.00
R2202:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2203:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2204:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2205:Flnc UTSW 6 29459508 missense probably damaging 1.00
R2209:Flnc UTSW 6 29455845 missense possibly damaging 0.91
R2248:Flnc UTSW 6 29451401 missense probably damaging 0.99
R2258:Flnc UTSW 6 29438666 nonsense probably null
R2259:Flnc UTSW 6 29438666 nonsense probably null
R2280:Flnc UTSW 6 29438666 nonsense probably null
R2281:Flnc UTSW 6 29438666 nonsense probably null
R2873:Flnc UTSW 6 29447543 missense probably damaging 0.96
R2900:Flnc UTSW 6 29448585 missense probably damaging 0.98
R3788:Flnc UTSW 6 29454057 missense probably damaging 0.99
R3799:Flnc UTSW 6 29443739 missense probably damaging 1.00
R3801:Flnc UTSW 6 29447404 missense probably damaging 0.98
R3851:Flnc UTSW 6 29453719 missense probably damaging 1.00
R3910:Flnc UTSW 6 29459427 missense probably damaging 1.00
R3982:Flnc UTSW 6 29442941 missense probably damaging 1.00
R3983:Flnc UTSW 6 29442941 missense probably damaging 1.00
R4023:Flnc UTSW 6 29451635 missense possibly damaging 0.95
R4676:Flnc UTSW 6 29445154 splice site probably null
R4694:Flnc UTSW 6 29443448 missense probably damaging 1.00
R4695:Flnc UTSW 6 29440429 missense probably damaging 0.99
R4735:Flnc UTSW 6 29455813 missense probably damaging 1.00
R4773:Flnc UTSW 6 29445039 missense possibly damaging 0.96
R4828:Flnc UTSW 6 29455167 missense probably damaging 1.00
R4856:Flnc UTSW 6 29447890 missense probably damaging 1.00
R4879:Flnc UTSW 6 29460806 missense probably damaging 0.99
R4899:Flnc UTSW 6 29446843 missense probably benign 0.17
R4906:Flnc UTSW 6 29447525 missense probably damaging 0.99
R5089:Flnc UTSW 6 29447813 missense probably damaging 0.96
R5173:Flnc UTSW 6 29455538 missense probably damaging 1.00
R5174:Flnc UTSW 6 29448894 missense possibly damaging 0.91
R5290:Flnc UTSW 6 29457554 missense probably damaging 1.00
R5338:Flnc UTSW 6 29444064 missense possibly damaging 0.47
R5352:Flnc UTSW 6 29449318 missense possibly damaging 0.85
R5397:Flnc UTSW 6 29441161 missense possibly damaging 0.87
R5431:Flnc UTSW 6 29456384 missense possibly damaging 0.74
R5481:Flnc UTSW 6 29441217 missense probably damaging 1.00
R5511:Flnc UTSW 6 29458898 missense probably damaging 1.00
R5539:Flnc UTSW 6 29446230 missense probably damaging 1.00
R5549:Flnc UTSW 6 29453691 missense probably damaging 1.00
R5567:Flnc UTSW 6 29444045 nonsense probably null
R5584:Flnc UTSW 6 29446628 missense probably damaging 0.98
R5689:Flnc UTSW 6 29441592 missense probably benign 0.03
R5753:Flnc UTSW 6 29433489 missense probably benign
R5786:Flnc UTSW 6 29459537 nonsense probably null
R5822:Flnc UTSW 6 29459430 missense probably damaging 0.98
R5823:Flnc UTSW 6 29461202 missense probably damaging 0.99
R5933:Flnc UTSW 6 29441106 missense probably damaging 0.99
R6043:Flnc UTSW 6 29446608 missense probably damaging 1.00
R6320:Flnc UTSW 6 29459063 missense probably damaging 1.00
R6337:Flnc UTSW 6 29454319 missense probably damaging 0.99
R6399:Flnc UTSW 6 29458883 missense probably damaging 1.00
R6423:Flnc UTSW 6 29445156 splice site probably null
R6540:Flnc UTSW 6 29446377 missense possibly damaging 0.96
R6547:Flnc UTSW 6 29448608 missense probably damaging 0.98
R6717:Flnc UTSW 6 29450902 small deletion probably benign
R6875:Flnc UTSW 6 29445749 missense probably damaging 1.00
R7193:Flnc UTSW 6 29450871 missense probably damaging 1.00
R7255:Flnc UTSW 6 29445766 missense probably damaging 1.00
R7303:Flnc UTSW 6 29460850 missense probably benign 0.31
R7413:Flnc UTSW 6 29452259 missense probably damaging 1.00
R7422:Flnc UTSW 6 29455471 missense probably damaging 1.00
R7559:Flnc UTSW 6 29459010 missense probably damaging 1.00
R7632:Flnc UTSW 6 29446985 missense probably damaging 0.98
R7651:Flnc UTSW 6 29444050 missense probably benign 0.08
R7679:Flnc UTSW 6 29456790 missense probably benign 0.00
R7788:Flnc UTSW 6 29456444 missense possibly damaging 0.67
Z1088:Flnc UTSW 6 29457151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGCTTTCTGTAGGAAACTG -3'
(R):5'- GTATCCAGTCTCCATGAACCC -3'

Sequencing Primer
(F):5'- AGATGGTGTCTGCCCAGGAG -3'
(R):5'- AGTCTCCATGAACCCCTCCC -3'
Posted On2019-11-12