Incidental Mutation 'R7697:Cntn3'
ID593707
Institutional Source Beutler Lab
Gene Symbol Cntn3
Ensembl Gene ENSMUSG00000030075
Gene Namecontactin 3
SynonymsPang
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location102162655-102573101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102208166 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 663 (V663E)
Ref Sequence ENSEMBL: ENSMUSP00000145176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]
Predicted Effect probably damaging
Transcript: ENSMUST00000032159
AA Change: V663E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: V663E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203619
AA Change: V663E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: V663E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 1.85e-7 SMART
IG 129 217 1.82e-6 SMART
IGc2 240 304 6.8e-15 SMART
IGc2 330 393 1.74e-12 SMART
IGc2 422 486 1.53e-8 SMART
IG 506 595 5.2e-11 SMART
FN3 598 684 3.4e-13 SMART
FN3 701 787 5.36e-2 SMART
FN3 803 888 4.63e-6 SMART
FN3 903 983 1.07e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Cntn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cntn3 APN 6 102420262 nonsense probably null
IGL00706:Cntn3 APN 6 102203949 missense probably benign 0.11
IGL01071:Cntn3 APN 6 102420251 critical splice donor site probably null
IGL01769:Cntn3 APN 6 102208184 missense probably damaging 1.00
IGL01995:Cntn3 APN 6 102203885 missense probably damaging 1.00
IGL02058:Cntn3 APN 6 102199360 splice site probably benign
IGL02736:Cntn3 APN 6 102203939 missense probably damaging 1.00
IGL02955:Cntn3 APN 6 102278301 missense probably damaging 1.00
IGL02971:Cntn3 APN 6 102168933 missense probably damaging 1.00
IGL03208:Cntn3 APN 6 102187099 missense probably damaging 0.99
P0037:Cntn3 UTSW 6 102209274 missense probably damaging 1.00
PIT4431001:Cntn3 UTSW 6 102464566 missense probably benign 0.22
R0314:Cntn3 UTSW 6 102420381 missense probably damaging 1.00
R0388:Cntn3 UTSW 6 102277316 missense probably damaging 0.96
R0483:Cntn3 UTSW 6 102203966 missense probably damaging 1.00
R0539:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R0543:Cntn3 UTSW 6 102269090 splice site probably benign
R0629:Cntn3 UTSW 6 102203976 missense probably damaging 1.00
R0691:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0693:Cntn3 UTSW 6 102168947 missense possibly damaging 0.48
R0781:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1110:Cntn3 UTSW 6 102245158 missense probably benign 0.22
R1144:Cntn3 UTSW 6 102242126 missense possibly damaging 0.65
R1503:Cntn3 UTSW 6 102464565 nonsense probably null
R1640:Cntn3 UTSW 6 102242013 missense possibly damaging 0.82
R1681:Cntn3 UTSW 6 102170668 missense probably damaging 1.00
R1770:Cntn3 UTSW 6 102269205 missense possibly damaging 0.49
R1782:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R1861:Cntn3 UTSW 6 102245071 missense probably benign 0.11
R1930:Cntn3 UTSW 6 102242053 nonsense probably null
R2026:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R2152:Cntn3 UTSW 6 102206537 missense probably damaging 1.00
R2313:Cntn3 UTSW 6 102203928 missense probably benign
R2351:Cntn3 UTSW 6 102337383 missense possibly damaging 0.55
R3611:Cntn3 UTSW 6 102208077 missense possibly damaging 0.77
R4349:Cntn3 UTSW 6 102199351 missense probably damaging 1.00
R4421:Cntn3 UTSW 6 102464547 missense probably damaging 0.97
R4513:Cntn3 UTSW 6 102168982 missense probably benign 0.37
R4678:Cntn3 UTSW 6 102204020 missense probably damaging 1.00
R4702:Cntn3 UTSW 6 102165331 missense probably benign 0.37
R4720:Cntn3 UTSW 6 102242022 missense possibly damaging 0.65
R4879:Cntn3 UTSW 6 102267428 missense possibly damaging 0.47
R4951:Cntn3 UTSW 6 102169025 missense possibly damaging 0.90
R5410:Cntn3 UTSW 6 102278353 missense probably benign 0.01
R5502:Cntn3 UTSW 6 102265334 missense possibly damaging 0.58
R5852:Cntn3 UTSW 6 102420416 missense probably damaging 1.00
R5903:Cntn3 UTSW 6 102242133 missense probably benign 0.00
R6193:Cntn3 UTSW 6 102208131 missense probably benign 0.31
R6258:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6260:Cntn3 UTSW 6 102277217 critical splice donor site probably null
R6350:Cntn3 UTSW 6 102170618 missense probably damaging 1.00
R6490:Cntn3 UTSW 6 102278340 missense probably damaging 0.99
R6993:Cntn3 UTSW 6 102278404 missense probably damaging 0.98
R7064:Cntn3 UTSW 6 102273811 missense probably damaging 0.97
R7085:Cntn3 UTSW 6 102165401 missense possibly damaging 0.85
R7174:Cntn3 UTSW 6 102165344 missense probably benign
R7208:Cntn3 UTSW 6 102278422 nonsense probably null
R7395:Cntn3 UTSW 6 102337394 critical splice acceptor site probably null
R7447:Cntn3 UTSW 6 102278455 nonsense probably null
R7571:Cntn3 UTSW 6 102278403 missense probably damaging 1.00
R7586:Cntn3 UTSW 6 102420427 missense probably damaging 1.00
R7614:Cntn3 UTSW 6 102165376 missense probably benign 0.17
R7697:Cntn3 UTSW 6 102208167 missense probably damaging 1.00
R7849:Cntn3 UTSW 6 102265431 missense probably benign 0.00
R8011:Cntn3 UTSW 6 102437899 missense possibly damaging 0.93
R8013:Cntn3 UTSW 6 102199317 missense probably benign 0.00
R8377:Cntn3 UTSW 6 102209293 missense probably benign 0.00
Z1088:Cntn3 UTSW 6 102420294 missense possibly damaging 0.74
Z1176:Cntn3 UTSW 6 102437931 critical splice acceptor site probably null
Z1177:Cntn3 UTSW 6 102337331 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGATCAGTGGCTTGGAGACC -3'
(R):5'- TCGTATGCAGTCCAAGCTAG -3'

Sequencing Primer
(F):5'- TGGCTTGGAGACCAGAGC -3'
(R):5'- AAGCTAGGACGCCTTTCTCTGTG -3'
Posted On2019-11-12