Incidental Mutation 'R7697:Acadsb'
ID593713
Institutional Source Beutler Lab
Gene Symbol Acadsb
Ensembl Gene ENSMUSG00000030861
Gene Nameacyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms1300003O09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location131410601-131448944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131429969 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 178 (E178G)
Ref Sequence ENSEMBL: ENSMUSP00000113948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015829] [ENSMUST00000117518] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000015829
AA Change: E178G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015829
Gene: ENSMUSG00000030861
AA Change: E178G

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 9.9e-30 PFAM
Pfam:Acyl-CoA_dh_M 173 268 6.9e-29 PFAM
Pfam:Acyl-CoA_dh_1 280 428 6.5e-51 PFAM
Pfam:Acyl-CoA_dh_2 295 418 4.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117518
AA Change: E178G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113948
Gene: ENSMUSG00000030861
AA Change: E178G

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 2.9e-29 PFAM
Pfam:Acyl-CoA_dh_M 173 268 1.2e-28 PFAM
Pfam:Acyl-CoA_dh_1 280 414 1.4e-41 PFAM
Pfam:Acyl-CoA_dh_2 295 415 2.6e-24 PFAM
transmembrane domain 417 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133277
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Acadsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Acadsb APN 7 131437496 intron probably benign
IGL02002:Acadsb APN 7 131428529 missense probably damaging 1.00
IGL02147:Acadsb APN 7 131425881 splice site probably benign
IGL02614:Acadsb APN 7 131424628 missense probably benign 0.00
IGL03038:Acadsb APN 7 131428456 missense probably damaging 1.00
IGL03083:Acadsb APN 7 131441193 intron probably benign
R0491:Acadsb UTSW 7 131430107 missense probably benign 0.41
R0562:Acadsb UTSW 7 131425789 nonsense probably null
R0989:Acadsb UTSW 7 131428544 missense probably damaging 0.99
R1701:Acadsb UTSW 7 131424484 missense probably benign 0.00
R1827:Acadsb UTSW 7 131441275 missense probably damaging 1.00
R1860:Acadsb UTSW 7 131444229 splice site probably null
R2256:Acadsb UTSW 7 131443653 missense probably benign 0.23
R3798:Acadsb UTSW 7 131431965 missense probably damaging 1.00
R4519:Acadsb UTSW 7 131430004 missense probably damaging 0.99
R5020:Acadsb UTSW 7 131441200 critical splice acceptor site probably null
R5048:Acadsb UTSW 7 131437469 missense probably damaging 1.00
R5243:Acadsb UTSW 7 131444243 missense probably damaging 1.00
R5519:Acadsb UTSW 7 131429965 missense probably damaging 1.00
R5788:Acadsb UTSW 7 131443599 missense probably benign 0.23
R5855:Acadsb UTSW 7 131424599 missense probably damaging 1.00
R6399:Acadsb UTSW 7 131430055 missense probably damaging 1.00
R6896:Acadsb UTSW 7 131443646 missense probably benign 0.23
R6970:Acadsb UTSW 7 131434315 missense possibly damaging 0.85
R7031:Acadsb UTSW 7 131443637 missense probably benign 0.23
R7126:Acadsb UTSW 7 131437448 missense probably benign 0.01
R7138:Acadsb UTSW 7 131441239 missense probably damaging 1.00
R7571:Acadsb UTSW 7 131443554 missense probably damaging 1.00
R8271:Acadsb UTSW 7 131443694 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTGCTTCTGAGAAAATAATAATCAC -3'
(R):5'- TGCCAACAAGTTACTTTAGATGAATGA -3'

Sequencing Primer
(F):5'- ATTCTGAGTTCAAGGCCAGC -3'
(R):5'- GGGAGGGAGGGAGGAGGTTC -3'
Posted On2019-11-12