Incidental Mutation 'R7697:Fhod1'
ID593714
Institutional Source Beutler Lab
Gene Symbol Fhod1
Ensembl Gene ENSMUSG00000014778
Gene Nameformin homology 2 domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105329163-105347953 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 105347931 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000073149]
Predicted Effect probably benign
Transcript: ENSMUST00000014922
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073149
SMART Domains Protein: ENSMUSP00000072893
Gene: ENSMUSG00000014786

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 39 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 458 9.8e-89 PFAM
low complexity region 705 723 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Fhod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Fhod1 APN 8 105332102 missense possibly damaging 0.66
IGL01149:Fhod1 APN 8 105347807 unclassified probably benign
IGL01325:Fhod1 APN 8 105331649 missense probably benign 0.33
IGL01470:Fhod1 APN 8 105329649 missense probably damaging 1.00
IGL01521:Fhod1 APN 8 105330423 missense probably benign 0.17
IGL01861:Fhod1 APN 8 105331176 missense probably damaging 1.00
IGL02864:Fhod1 APN 8 105337164 unclassified probably benign
IGL02951:Fhod1 APN 8 105331230 missense probably damaging 1.00
reactive UTSW 8 105336434 unclassified probably benign
treason UTSW 8 105337350 unclassified probably benign
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0498:Fhod1 UTSW 8 105329856 missense probably damaging 1.00
R1234:Fhod1 UTSW 8 105337163 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1485:Fhod1 UTSW 8 105336798 critical splice acceptor site probably null
R1585:Fhod1 UTSW 8 105337325 unclassified probably benign
R1615:Fhod1 UTSW 8 105347831 unclassified probably benign
R1778:Fhod1 UTSW 8 105329677 missense probably damaging 1.00
R1781:Fhod1 UTSW 8 105347789 unclassified probably benign
R2291:Fhod1 UTSW 8 105336964 unclassified probably benign
R2864:Fhod1 UTSW 8 105332911 missense probably null 0.97
R2865:Fhod1 UTSW 8 105332911 missense probably null 0.97
R3775:Fhod1 UTSW 8 105331638 unclassified probably benign
R4107:Fhod1 UTSW 8 105338038 unclassified probably benign
R4422:Fhod1 UTSW 8 105337351 unclassified probably benign
R4423:Fhod1 UTSW 8 105337351 unclassified probably benign
R4424:Fhod1 UTSW 8 105337351 unclassified probably benign
R4425:Fhod1 UTSW 8 105337351 unclassified probably benign
R4641:Fhod1 UTSW 8 105329592 missense probably damaging 1.00
R4724:Fhod1 UTSW 8 105337861 unclassified probably benign
R4757:Fhod1 UTSW 8 105347811 unclassified probably benign
R5004:Fhod1 UTSW 8 105336945 unclassified probably benign
R5082:Fhod1 UTSW 8 105330513 missense probably damaging 1.00
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6298:Fhod1 UTSW 8 105337148 unclassified probably benign
R6320:Fhod1 UTSW 8 105337350 unclassified probably benign
R6362:Fhod1 UTSW 8 105331641 critical splice donor site probably null
R6449:Fhod1 UTSW 8 105330237 missense probably damaging 1.00
R6736:Fhod1 UTSW 8 105337890 unclassified probably benign
R6816:Fhod1 UTSW 8 105330544 missense probably benign 0.10
R6955:Fhod1 UTSW 8 105333007 missense probably benign 0.00
R7073:Fhod1 UTSW 8 105337139 missense unknown
R7567:Fhod1 UTSW 8 105347837 missense unknown
R7789:Fhod1 UTSW 8 105330108 missense probably damaging 1.00
R7894:Fhod1 UTSW 8 105331157 missense probably damaging 1.00
R8105:Fhod1 UTSW 8 105337215 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGAAGCACTGTCTGTCCACC -3'
(R):5'- GATCACCAGCTCTCTGAGTG -3'

Sequencing Primer
(F):5'- TTCCGGGAAGTTGGCAC -3'
(R):5'- CAGCTCTCTGAGTGGCTGG -3'
Posted On2019-11-12