Incidental Mutation 'R7697:Siae'
ID593716
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Namesialic acid acetylesterase
SynonymsLSE, clone 165, Ysg2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37555698-37649655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37633654 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 315 (Y315C)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000213126] [ENSMUST00000215474]
Predicted Effect probably damaging
Transcript: ENSMUST00000002007
AA Change: Y243C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942
AA Change: Y243C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213126
AA Change: Y280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215474
AA Change: Y315C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
BB009:Siae UTSW 9 37633684 missense probably benign 0.12
BB019:Siae UTSW 9 37633684 missense probably benign 0.12
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
R7821:Siae UTSW 9 37644900 missense probably damaging 1.00
R7932:Siae UTSW 9 37633684 missense probably benign 0.12
R8312:Siae UTSW 9 37646297 missense
R8377:Siae UTSW 9 37631605 critical splice donor site probably null
Z1176:Siae UTSW 9 37631469 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTGTACCATGCTTGCTGAAG -3'
(R):5'- ACAAATGTTGGGCTGCAAATCC -3'

Sequencing Primer
(F):5'- TGAAGCCTCTGACACCTGAG -3'
(R):5'- GGGCTGCAAATCCCAGTACAG -3'
Posted On2019-11-12