Incidental Mutation 'R7697:Cspg5'
ID593719
Institutional Source Beutler Lab
Gene Symbol Cspg5
Ensembl Gene ENSMUSG00000032482
Gene Namechondroitin sulfate proteoglycan 5
SynonymsCALEB, neuroglycan C, NGC
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110243783-110262576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 110256226 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 488 (R488S)
Ref Sequence ENSEMBL: ENSMUSP00000035058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035058] [ENSMUST00000196060] [ENSMUST00000197850] [ENSMUST00000199736]
Predicted Effect probably damaging
Transcript: ENSMUST00000035058
AA Change: R488S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035058
Gene: ENSMUSG00000032482
AA Change: R488S

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Chon_Sulph_att 33 278 2.5e-123 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 565 5.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196060
SMART Domains Protein: ENSMUSP00000143164
Gene: ENSMUSG00000032482

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 487 8.9e-26 PFAM
Pfam:Neural_ProG_Cyt 486 539 1.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197850
AA Change: R488S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143005
Gene: ENSMUSG00000032482
AA Change: R488S

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1.1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 520 1.5e-45 PFAM
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199736
SMART Domains Protein: ENSMUSP00000142845
Gene: ENSMUSG00000032482

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 1 197 1.6e-99 PFAM
low complexity region 209 221 N/A INTRINSIC
EGF 292 332 9.5e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 366 406 1.2e-22 PFAM
Pfam:Neural_ProG_Cyt 405 458 1.7e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a chondroitin sulfate proteoglycan. The encoded protein has been termed a 'part-time' proteoglycan, as chondroitin sulfate chains appear to be attached to the protein in the developing but not the adult cerebellum and retina. It is thought that this protein plays roles in dendrite branching and synapse formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display decreased spontaneous postsynaptic currents, increased paired-pulse ratios, and reduced long term depression during early postnatal developmental stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Cspg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Cspg5 APN 9 110256168 missense probably damaging 1.00
IGL01516:Cspg5 APN 9 110246693 missense probably benign 0.37
IGL01800:Cspg5 APN 9 110251150 splice site probably benign
IGL01927:Cspg5 APN 9 110262084 missense probably damaging 0.99
IGL02164:Cspg5 APN 9 110251036 missense probably damaging 0.98
IGL02338:Cspg5 APN 9 110256267 missense probably benign 0.04
IGL02421:Cspg5 APN 9 110247392 critical splice donor site probably benign
R0106:Cspg5 UTSW 9 110246532 missense probably damaging 0.96
R0540:Cspg5 UTSW 9 110247392 critical splice donor site probably null
R0905:Cspg5 UTSW 9 110246526 missense probably damaging 0.99
R1772:Cspg5 UTSW 9 110262138 missense probably damaging 1.00
R1959:Cspg5 UTSW 9 110251026 missense probably damaging 1.00
R4356:Cspg5 UTSW 9 110256177 missense probably damaging 1.00
R4771:Cspg5 UTSW 9 110251127 missense probably damaging 1.00
R5345:Cspg5 UTSW 9 110246630 missense probably benign 0.03
R5441:Cspg5 UTSW 9 110246643 missense probably benign
R5474:Cspg5 UTSW 9 110251008 missense probably damaging 1.00
R5946:Cspg5 UTSW 9 110251083 missense probably damaging 0.99
R6890:Cspg5 UTSW 9 110246784 missense probably damaging 0.98
R7028:Cspg5 UTSW 9 110246891 missense possibly damaging 0.85
R7286:Cspg5 UTSW 9 110246955 missense probably damaging 1.00
R7858:Cspg5 UTSW 9 110251066 missense probably damaging 1.00
X0020:Cspg5 UTSW 9 110247173 missense probably damaging 0.96
Z1176:Cspg5 UTSW 9 110251050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACTCCCAAGGGCAAGTC -3'
(R):5'- TGACTGCCTACTCTGAGACAGG -3'

Sequencing Primer
(F):5'- CAGGCCTGGTGCATCTTAC -3'
(R):5'- CCTACTCTGAGACAGGGCAAG -3'
Posted On2019-11-12