Incidental Mutation 'R7697:Mrps7'
ID593726
Institutional Source Beutler Lab
Gene Symbol Mrps7
Ensembl Gene ENSMUSG00000046756
Gene Namemitchondrial ribosomal protein S7
SynonymsMRP-S7, Rpms7
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115603925-115608036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115604875 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000053033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021087] [ENSMUST00000058109] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000106508] [ENSMUST00000125097] [ENSMUST00000148574] [ENSMUST00000156173]
Predicted Effect probably benign
Transcript: ENSMUST00000019135
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021087
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058109
AA Change: T80A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053033
Gene: ENSMUSG00000046756
AA Change: T80A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_S7 68 234 7.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106506
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106507
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106508
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125097
SMART Domains Protein: ENSMUSP00000118024
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
Pfam:VHS 3 106 3.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148574
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156173
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. In the prokaryotic ribosome, the comparable protein is thought to play an essential role in organizing the 3' domain of the 16 S rRNA in the vicinity of the P- and A-sites. Pseudogenes corresponding to this gene are found on chromosomes 8p and 12p. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Mrps7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Mrps7 APN 11 115604858 missense possibly damaging 0.78
IGL02928:Mrps7 APN 11 115605084 nonsense probably null
R1494:Mrps7 UTSW 11 115604126 unclassified probably benign
R1501:Mrps7 UTSW 11 115604197 missense probably benign 0.00
R1651:Mrps7 UTSW 11 115604755 nonsense probably null
R1830:Mrps7 UTSW 11 115606985 missense probably benign 0.01
R2895:Mrps7 UTSW 11 115605039 missense probably benign 0.01
R5155:Mrps7 UTSW 11 115604829 nonsense probably null
R6076:Mrps7 UTSW 11 115604887 missense probably damaging 0.99
R6144:Mrps7 UTSW 11 115604174 missense probably benign 0.43
R6180:Mrps7 UTSW 11 115604881 missense possibly damaging 0.95
R7421:Mrps7 UTSW 11 115604891 missense probably benign 0.22
R7541:Mrps7 UTSW 11 115606870 missense probably damaging 0.97
R7981:Mrps7 UTSW 11 115606861 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGGAGTCACAGATTCACCCG -3'
(R):5'- GCCAGAACTTTGTTGCCTC -3'

Sequencing Primer
(F):5'- CGTAGGGTTCTGTCTGCTTCC -3'
(R):5'- TCCCTTCATCATCATGTTGGTG -3'
Posted On2019-11-12