Incidental Mutation 'R7697:Adcy8'
ID593734
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 64747001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 768 (I768L)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
Predicted Effect probably benign
Transcript: ENSMUST00000023007
AA Change: I768L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: I768L

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228014
AA Change: I768L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 splice site probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64921033 missense probably benign
R7644:Adcy8 UTSW 15 64699369 missense possibly damaging 0.77
R7735:Adcy8 UTSW 15 64783780 missense probably benign 0.10
R7789:Adcy8 UTSW 15 64871774 nonsense probably null
R7860:Adcy8 UTSW 15 64699473 missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64920205 missense possibly damaging 0.60
R7948:Adcy8 UTSW 15 64815350 missense possibly damaging 0.80
R7966:Adcy8 UTSW 15 64702090 missense probably damaging 1.00
R8024:Adcy8 UTSW 15 64920246 missense probably damaging 1.00
R8097:Adcy8 UTSW 15 64871862 splice site probably null
R8158:Adcy8 UTSW 15 64783806 missense probably benign 0.32
Z1176:Adcy8 UTSW 15 64725518 missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64699177 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTTGGGGCTGACTGGAAC -3'
(R):5'- GCAAGATTTCCAGGGCCATTG -3'

Sequencing Primer
(F):5'- CAAGAAGTTGCTGGTTCTCTAAGCTC -3'
(R):5'- CCATTGGGTGGGGATGGG -3'
Posted On2019-11-12