Incidental Mutation 'R7697:Csrnp2'
ID593736
Institutional Source Beutler Lab
Gene Symbol Csrnp2
Ensembl Gene ENSMUSG00000044636
Gene Namecysteine-serine-rich nuclear protein 2
SynonymsCSRNP-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location100479570-100495488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100488072 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 95 (M95K)
Ref Sequence ENSEMBL: ENSMUSP00000052144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061457]
Predicted Effect probably damaging
Transcript: ENSMUST00000061457
AA Change: M95K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052144
Gene: ENSMUSG00000044636
AA Change: M95K

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:CSRNP_N 61 280 5e-106 PFAM
low complexity region 330 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CSRNP family of nuclear proteins that share conserved regions, including cysteine- and serine- rich regions, a basic domain, a transcriptional activation domain, and bind the sequence 'AGAGTG', thus have the hallmark of transcription factors. Studies in mice suggest that these genes may have redundant functions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy and display normal development, hematopoiesis and T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Csrnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Csrnp2 APN 15 100484643 missense probably benign 0.21
R0674:Csrnp2 UTSW 15 100487991 missense probably damaging 1.00
R1988:Csrnp2 UTSW 15 100489440 missense probably damaging 1.00
R3683:Csrnp2 UTSW 15 100481998 missense probably benign
R4688:Csrnp2 UTSW 15 100482360 missense probably damaging 0.97
R4846:Csrnp2 UTSW 15 100484690 missense probably damaging 1.00
R5429:Csrnp2 UTSW 15 100482054 missense probably benign
R5678:Csrnp2 UTSW 15 100481804 makesense probably null
R6056:Csrnp2 UTSW 15 100482382 missense probably benign 0.23
R6765:Csrnp2 UTSW 15 100482693 missense probably damaging 1.00
R6925:Csrnp2 UTSW 15 100481958 missense probably benign 0.03
R7513:Csrnp2 UTSW 15 100482416 missense probably benign 0.10
R8081:Csrnp2 UTSW 15 100489581 missense probably damaging 0.98
X0020:Csrnp2 UTSW 15 100484703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCAGGCACCTTCATTTC -3'
(R):5'- AGAGCCTCCCTCGATACTAAGG -3'

Sequencing Primer
(F):5'- GCAGGCACCTTCATTTCACCAG -3'
(R):5'- CCTCGATACTAAGGGCAGGTG -3'
Posted On2019-11-12