Incidental Mutation 'R7697:Olfr15'
ID593737
Institutional Source Beutler Lab
Gene Symbol Olfr15
Ensembl Gene ENSMUSG00000059043
Gene Nameolfactory receptor 15
SynonymsOR3, GA_x54KRFPKG5P-348087-349025, MOR256-17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location3830878-3844747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3839566 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 198 (V198M)
Ref Sequence ENSEMBL: ENSMUSP00000149504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080917] [ENSMUST00000214238] [ENSMUST00000214590]
Predicted Effect probably damaging
Transcript: ENSMUST00000080917
AA Change: V198M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079720
Gene: ENSMUSG00000059043
AA Change: V198M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 25 301 2.7e-8 PFAM
Pfam:7tm_4 31 307 1.3e-52 PFAM
Pfam:7tm_1 41 290 9.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214238
AA Change: V198M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214590
AA Change: V198M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Olfr15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr15 APN 16 3839777 missense probably damaging 0.99
IGL02444:Olfr15 APN 16 3839687 missense probably damaging 1.00
IGL02516:Olfr15 APN 16 3839336 missense probably damaging 1.00
IGL02941:Olfr15 APN 16 3839816 missense possibly damaging 0.64
PIT4812001:Olfr15 UTSW 16 3839530 nonsense probably null
R0380:Olfr15 UTSW 16 3838985 missense probably benign
R1542:Olfr15 UTSW 16 3839832 missense probably damaging 1.00
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1574:Olfr15 UTSW 16 3839657 missense probably damaging 0.99
R1633:Olfr15 UTSW 16 3839532 missense probably damaging 1.00
R4207:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R4632:Olfr15 UTSW 16 3839087 missense probably damaging 1.00
R4965:Olfr15 UTSW 16 3839570 missense probably damaging 1.00
R5014:Olfr15 UTSW 16 3839048 missense probably benign 0.01
R6575:Olfr15 UTSW 16 3839030 missense probably benign 0.00
R7367:Olfr15 UTSW 16 3839302 missense probably damaging 0.99
R7523:Olfr15 UTSW 16 3839699 missense probably benign
R7876:Olfr15 UTSW 16 3838794 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGACCGTCATGAATCCTCGC -3'
(R):5'- TACTGCTCTTAGCTGGAAGC -3'

Sequencing Primer
(F):5'- ATGAATCCTCGCCTCTGCTGG -3'
(R):5'- CTGGAAGCAGATACCCATAGATCG -3'
Posted On2019-11-12