Incidental Mutation 'R7697:Notch4'
ID593740
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Namenotch 4
SynonymsInt3, N4, Int-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34564268-34588503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34570185 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 486 (T486I)
Ref Sequence ENSEMBL: ENSMUSP00000015612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]
Predicted Effect probably damaging
Transcript: ENSMUST00000015612
AA Change: T486I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: T486I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173389
AA Change: T490I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468
AA Change: T490I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34575561 critical splice donor site probably null
IGL01022:Notch4 APN 17 34565697 missense probably damaging 1.00
IGL01356:Notch4 APN 17 34581026 missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34572588 missense probably damaging 1.00
IGL02150:Notch4 APN 17 34584613 missense probably damaging 1.00
IGL02248:Notch4 APN 17 34587198 missense probably damaging 1.00
IGL02271:Notch4 APN 17 34568471 missense probably damaging 1.00
IGL02299:Notch4 APN 17 34578004 missense probably damaging 1.00
IGL02561:Notch4 APN 17 34568160 splice site probably benign
IGL02604:Notch4 APN 17 34565388 splice site probably null
IGL03323:Notch4 APN 17 34582471 missense probably damaging 1.00
IGL03366:Notch4 APN 17 34572568 missense probably damaging 1.00
IGL03408:Notch4 APN 17 34565568 missense probably benign 0.03
K3955:Notch4 UTSW 17 34568462 missense probably damaging 1.00
R0123:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34581499 splice site probably benign
R0446:Notch4 UTSW 17 34565363 missense possibly damaging 0.85
R0490:Notch4 UTSW 17 34582890 missense probably damaging 1.00
R0504:Notch4 UTSW 17 34575091 missense probably damaging 1.00
R0545:Notch4 UTSW 17 34583433 missense probably damaging 1.00
R0702:Notch4 UTSW 17 34575203 missense probably damaging 1.00
R0763:Notch4 UTSW 17 34565332 nonsense probably null
R0854:Notch4 UTSW 17 34568572 missense probably damaging 1.00
R1082:Notch4 UTSW 17 34587390 missense probably damaging 1.00
R1196:Notch4 UTSW 17 34568863 missense probably damaging 1.00
R1316:Notch4 UTSW 17 34567470 missense probably damaging 1.00
R1493:Notch4 UTSW 17 34567682 nonsense probably null
R1527:Notch4 UTSW 17 34565744 missense probably damaging 1.00
R1548:Notch4 UTSW 17 34568422 missense probably damaging 1.00
R1718:Notch4 UTSW 17 34576763 splice site probably benign
R1855:Notch4 UTSW 17 34580962 missense probably benign 0.05
R1988:Notch4 UTSW 17 34587588 missense possibly damaging 0.59
R2022:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2023:Notch4 UTSW 17 34587528 missense probably damaging 1.00
R2078:Notch4 UTSW 17 34568715 critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34585950 missense probably benign 0.15
R3846:Notch4 UTSW 17 34578097 missense probably damaging 1.00
R3874:Notch4 UTSW 17 34578069 nonsense probably null
R4087:Notch4 UTSW 17 34584435 missense probably damaging 1.00
R4456:Notch4 UTSW 17 34583833 missense probably damaging 0.99
R4628:Notch4 UTSW 17 34570185 missense probably damaging 1.00
R4728:Notch4 UTSW 17 34570205 missense probably benign 0.00
R4778:Notch4 UTSW 17 34582511 missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34578716 splice site probably benign
R4828:Notch4 UTSW 17 34570060 missense probably damaging 1.00
R4830:Notch4 UTSW 17 34570118 missense probably damaging 1.00
R4859:Notch4 UTSW 17 34587180 missense probably damaging 1.00
R4871:Notch4 UTSW 17 34577562 missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34580920 missense probably damaging 0.99
R5290:Notch4 UTSW 17 34565289 missense probably benign 0.01
R5363:Notch4 UTSW 17 34587123 missense probably damaging 1.00
R5860:Notch4 UTSW 17 34582418 missense probably damaging 1.00
R6352:Notch4 UTSW 17 34567461 missense probably damaging 1.00
R6385:Notch4 UTSW 17 34573814 missense probably null 0.16
R6422:Notch4 UTSW 17 34584559 missense probably benign
R6645:Notch4 UTSW 17 34587816 missense probably benign 0.00
R6836:Notch4 UTSW 17 34586100 missense probably damaging 0.96
R6943:Notch4 UTSW 17 34583603 missense probably benign
R6991:Notch4 UTSW 17 34584800 nonsense probably null
R7078:Notch4 UTSW 17 34582546 missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34572693 missense probably benign 0.05
R7182:Notch4 UTSW 17 34583499 missense probably damaging 1.00
R7240:Notch4 UTSW 17 34576471 missense probably benign 0.00
R7247:Notch4 UTSW 17 34572517 missense probably damaging 1.00
R7556:Notch4 UTSW 17 34575470 missense probably damaging 1.00
R7571:Notch4 UTSW 17 34583574 missense probably damaging 0.99
R7763:Notch4 UTSW 17 34582418 missense probably damaging 1.00
R7994:Notch4 UTSW 17 34578090 missense possibly damaging 0.82
R8139:Notch4 UTSW 17 34584800 nonsense probably null
R8171:Notch4 UTSW 17 34582509 nonsense probably null
R8375:Notch4 UTSW 17 34568254 missense possibly damaging 0.90
R8448:Notch4 UTSW 17 34586789 splice site probably null
X0054:Notch4 UTSW 17 34584495 missense probably damaging 1.00
X0067:Notch4 UTSW 17 34586084 nonsense probably null
Z1088:Notch4 UTSW 17 34587915 missense probably damaging 1.00
Z1177:Notch4 UTSW 17 34575148 missense probably damaging 1.00
Z1177:Notch4 UTSW 17 34587908 missense probably damaging 0.97
Z1177:Notch4 UTSW 17 34587909 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCATCTCCACATACAAGTGTCC -3'
(R):5'- GGGTTCCCCAGTTTTAGCTG -3'

Sequencing Primer
(F):5'- ACACACCTTCCCTGTCAGTCTAG -3'
(R):5'- AGCTGGGTGTGGGGAGAG -3'
Posted On2019-11-12