Incidental Mutation 'R7698:Cenpf'
ID593752
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R7698 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 189662072 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 479 (C479S)
Ref Sequence ENSEMBL: ENSMUSP00000132759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165962
AA Change: C479S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605
AA Change: C479S

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171929
AA Change: C496S

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: C496S

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,625,371 E482A probably benign Het
A630023A22Rik C A 14: 34,052,613 L140F unknown Het
Actn1 T C 12: 80,174,537 T581A probably benign Het
AI314180 C G 4: 58,832,660 C900S unknown Het
Ak9 T C 10: 41,348,076 L495S Het
Aldh5a1 T C 13: 24,911,748 D462G probably damaging Het
Amz2 A G 11: 109,429,007 D73G probably damaging Het
Ank2 A G 3: 127,032,211 Y361H probably benign Het
Atp8b1 A G 18: 64,571,022 Y342H probably benign Het
Atp8b5 C T 4: 43,366,735 T833I probably benign Het
Camkk2 A G 5: 122,746,419 I313T probably damaging Het
Cdk18 T C 1: 132,122,378 T20A probably damaging Het
Cfap221 C A 1: 119,961,929 E192* probably null Het
Cfap44 C T 16: 44,433,786 H958Y probably damaging Het
Cic A T 7: 25,273,172 Q776L possibly damaging Het
Cldn17 C A 16: 88,506,356 G162* probably null Het
Col19a1 T A 1: 24,312,078 Y748F probably benign Het
Col27a1 C T 4: 63,225,718 P548S possibly damaging Het
Ctsr T A 13: 61,162,567 M92L probably benign Het
Cyp2d12 T C 15: 82,558,970 V360A probably benign Het
Defa34 G T 8: 21,666,629 C91F probably damaging Het
Dennd2c G A 3: 103,165,043 V815I possibly damaging Het
Dlgap4 C T 2: 156,749,095 Q734* probably null Het
Dph1 A T 11: 75,190,441 S7T probably benign Het
Dpp8 T C 9: 65,042,336 V121A probably benign Het
Dst G A 1: 34,190,387 G2354S probably benign Het
Duox2 A T 2: 122,280,764 L1453Q probably damaging Het
Exosc10 T A 4: 148,558,498 S11T probably benign Het
Fetub A G 16: 22,939,309 T281A probably benign Het
Flii A T 11: 60,720,092 W504R probably damaging Het
Gm17727 T C 9: 35,777,176 M38V probably benign Het
Gm5093 T C 17: 46,439,940 R54G possibly damaging Het
Gmcl1 T C 6: 86,707,415 D375G probably benign Het
Hikeshi A T 7: 89,923,681 N101K probably benign Het
Hmcn2 T C 2: 31,423,153 V3458A probably damaging Het
Hspa2 A G 12: 76,405,309 N259S possibly damaging Het
Irf6 T C 1: 193,161,767 I110T probably damaging Het
Kcnj8 T A 6: 142,565,753 H376L probably damaging Het
Kdm6b G A 11: 69,405,981 P487S probably benign Het
Lcp1 C A 14: 75,206,211 Y222* probably null Het
Manea T C 4: 26,327,763 D426G probably damaging Het
Map3k20 G T 2: 72,364,681 E101* probably null Het
Map3k20 C G 2: 72,438,314 S555C probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myo6 C T 9: 80,217,656 P6S unknown Het
Myoc A T 1: 162,639,445 Q61L probably damaging Het
N4bp2 T A 5: 65,808,157 M1183K probably benign Het
Olfr1444 T C 19: 12,862,713 S313P possibly damaging Het
Olfr1468-ps1 T C 19: 13,375,040 F26S probably damaging Het
Olfr676 T A 7: 105,035,907 H236Q probably benign Het
Olfr889 T A 9: 38,115,892 L37* probably null Het
Osbpl11 C G 16: 33,234,447 N633K probably benign Het
Pcdhgb5 A G 18: 37,732,631 E493G probably damaging Het
Phf20 T A 2: 156,294,138 W626R probably damaging Het
Pkp2 C A 16: 16,240,659 Q402K probably benign Het
Plch2 C T 4: 155,002,787 D336N possibly damaging Het
Plk1 T C 7: 122,169,258 F535L probably damaging Het
Ppp1r9a A T 6: 4,906,430 E328D probably benign Het
Prss44 G A 9: 110,817,311 V369M probably benign Het
Rilp A G 11: 75,510,972 S193G probably benign Het
Rusc2 C T 4: 43,414,900 Q69* probably null Het
Ryr2 T C 13: 11,761,315 D1112G possibly damaging Het
Smc6 A G 12: 11,283,140 R238G possibly damaging Het
Spen A G 4: 141,472,845 S2824P probably damaging Het
Stk4 T C 2: 164,083,743 M77T probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Thsd1 C T 8: 22,258,987 R625* probably null Het
Tle3 A T 9: 61,412,856 N522I probably damaging Het
Tmcc1 C A 6: 116,043,802 E230* probably null Het
Vmn2r90 T C 17: 17,733,334 S587P probably benign Het
Wt1 A T 2: 105,126,816 Q7L probably benign Het
Zfhx2 T C 14: 55,062,849 I2482V probably benign Het
Zfpm2 A T 15: 41,096,091 I189F probably benign Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
R7353:Cenpf UTSW 1 189654138 nonsense probably null
R7402:Cenpf UTSW 1 189659378 nonsense probably null
R7460:Cenpf UTSW 1 189654050 missense probably damaging 0.97
R7484:Cenpf UTSW 1 189656821 missense probably damaging 1.00
R7574:Cenpf UTSW 1 189658667 missense probably damaging 1.00
R7691:Cenpf UTSW 1 189658207 nonsense probably null
RF006:Cenpf UTSW 1 189657386 missense probably damaging 1.00
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAAAGGAGAGTTTTCCTAGAC -3'
(R):5'- GAAGAAGCATATTTCCTGACGG -3'

Sequencing Primer
(F):5'- GGAGAGTTTTCCTAGACAGACACAC -3'
(R):5'- GAAGCATATTTCCTGACGGTATAAG -3'
Posted On2019-11-12