Incidental Mutation 'R7698:Phf20'
ID593759
Institutional Source Beutler Lab
Gene Symbol Phf20
Ensembl Gene ENSMUSG00000038116
Gene NamePHD finger protein 20
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R7698 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156196466-156309952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156294138 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 626 (W626R)
Ref Sequence ENSEMBL: ENSMUSP00000043138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037401]
Predicted Effect probably damaging
Transcript: ENSMUST00000037401
AA Change: W626R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043138
Gene: ENSMUSG00000038116
AA Change: W626R

DomainStartEndE-ValueType
TUDOR 11 71 5.27e0 SMART
TUDOR 85 141 7.13e-4 SMART
AT_hook 257 269 1.65e0 SMART
low complexity region 323 332 N/A INTRINSIC
ZnF_C2H2 455 480 1.86e0 SMART
low complexity region 486 493 N/A INTRINSIC
low complexity region 526 555 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
PHD 657 701 2.83e-4 SMART
coiled coil region 945 966 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased body size and total body fat amount, and abnormal skeletal and hematopoietic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,625,371 E482A probably benign Het
A630023A22Rik C A 14: 34,052,613 L140F unknown Het
Actn1 T C 12: 80,174,537 T581A probably benign Het
AI314180 C G 4: 58,832,660 C900S unknown Het
Ak9 T C 10: 41,348,076 L495S Het
Aldh5a1 T C 13: 24,911,748 D462G probably damaging Het
Amz2 A G 11: 109,429,007 D73G probably damaging Het
Ank2 A G 3: 127,032,211 Y361H probably benign Het
Atp8b1 A G 18: 64,571,022 Y342H probably benign Het
Atp8b5 C T 4: 43,366,735 T833I probably benign Het
Camkk2 A G 5: 122,746,419 I313T probably damaging Het
Cdk18 T C 1: 132,122,378 T20A probably damaging Het
Cenpf A T 1: 189,662,072 C479S probably benign Het
Cfap221 C A 1: 119,961,929 E192* probably null Het
Cfap44 C T 16: 44,433,786 H958Y probably damaging Het
Cic A T 7: 25,273,172 Q776L possibly damaging Het
Cldn17 C A 16: 88,506,356 G162* probably null Het
Col19a1 T A 1: 24,312,078 Y748F probably benign Het
Col27a1 C T 4: 63,225,718 P548S possibly damaging Het
Ctsr T A 13: 61,162,567 M92L probably benign Het
Cyp2d12 T C 15: 82,558,970 V360A probably benign Het
Defa34 G T 8: 21,666,629 C91F probably damaging Het
Dennd2c G A 3: 103,165,043 V815I possibly damaging Het
Dlgap4 C T 2: 156,749,095 Q734* probably null Het
Dph1 A T 11: 75,190,441 S7T probably benign Het
Dpp8 T C 9: 65,042,336 V121A probably benign Het
Dst G A 1: 34,190,387 G2354S probably benign Het
Duox2 A T 2: 122,280,764 L1453Q probably damaging Het
Exosc10 T A 4: 148,558,498 S11T probably benign Het
Fetub A G 16: 22,939,309 T281A probably benign Het
Flii A T 11: 60,720,092 W504R probably damaging Het
Gm17727 T C 9: 35,777,176 M38V probably benign Het
Gm5093 T C 17: 46,439,940 R54G possibly damaging Het
Gmcl1 T C 6: 86,707,415 D375G probably benign Het
Hikeshi A T 7: 89,923,681 N101K probably benign Het
Hmcn2 T C 2: 31,423,153 V3458A probably damaging Het
Hspa2 A G 12: 76,405,309 N259S possibly damaging Het
Irf6 T C 1: 193,161,767 I110T probably damaging Het
Kcnj8 T A 6: 142,565,753 H376L probably damaging Het
Kdm6b G A 11: 69,405,981 P487S probably benign Het
Lcp1 C A 14: 75,206,211 Y222* probably null Het
Manea T C 4: 26,327,763 D426G probably damaging Het
Map3k20 G T 2: 72,364,681 E101* probably null Het
Map3k20 C G 2: 72,438,314 S555C probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myo6 C T 9: 80,217,656 P6S unknown Het
Myoc A T 1: 162,639,445 Q61L probably damaging Het
N4bp2 T A 5: 65,808,157 M1183K probably benign Het
Olfr1444 T C 19: 12,862,713 S313P possibly damaging Het
Olfr1468-ps1 T C 19: 13,375,040 F26S probably damaging Het
Olfr676 T A 7: 105,035,907 H236Q probably benign Het
Olfr889 T A 9: 38,115,892 L37* probably null Het
Osbpl11 C G 16: 33,234,447 N633K probably benign Het
Pcdhgb5 A G 18: 37,732,631 E493G probably damaging Het
Pkp2 C A 16: 16,240,659 Q402K probably benign Het
Plch2 C T 4: 155,002,787 D336N possibly damaging Het
Plk1 T C 7: 122,169,258 F535L probably damaging Het
Ppp1r9a A T 6: 4,906,430 E328D probably benign Het
Prss44 G A 9: 110,817,311 V369M probably benign Het
Rilp A G 11: 75,510,972 S193G probably benign Het
Rusc2 C T 4: 43,414,900 Q69* probably null Het
Ryr2 T C 13: 11,761,315 D1112G possibly damaging Het
Smc6 A G 12: 11,283,140 R238G possibly damaging Het
Spen A G 4: 141,472,845 S2824P probably damaging Het
Stk4 T C 2: 164,083,743 M77T probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Thsd1 C T 8: 22,258,987 R625* probably null Het
Tle3 A T 9: 61,412,856 N522I probably damaging Het
Tmcc1 C A 6: 116,043,802 E230* probably null Het
Vmn2r90 T C 17: 17,733,334 S587P probably benign Het
Wt1 A T 2: 105,126,816 Q7L probably benign Het
Zfhx2 T C 14: 55,062,849 I2482V probably benign Het
Zfpm2 A T 15: 41,096,091 I189F probably benign Het
Other mutations in Phf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Phf20 APN 2 156304816 critical splice donor site probably null
IGL01071:Phf20 APN 2 156294088 splice site probably null
IGL01125:Phf20 APN 2 156303184 splice site probably null
IGL01608:Phf20 APN 2 156276596 missense probably benign
IGL01610:Phf20 APN 2 156302889 nonsense probably null
IGL01845:Phf20 APN 2 156276657 nonsense probably null
IGL02364:Phf20 APN 2 156294097 missense possibly damaging 0.80
IGL02692:Phf20 APN 2 156298578 missense probably damaging 1.00
IGL03039:Phf20 APN 2 156298541 missense probably damaging 1.00
R0016:Phf20 UTSW 2 156267194 nonsense probably null
R0189:Phf20 UTSW 2 156303141 missense probably benign 0.02
R1532:Phf20 UTSW 2 156303049 missense possibly damaging 0.89
R1572:Phf20 UTSW 2 156287834 missense probably benign 0.17
R2007:Phf20 UTSW 2 156287954 missense probably benign 0.00
R2191:Phf20 UTSW 2 156276654 missense probably benign
R3011:Phf20 UTSW 2 156288026 missense probably benign 0.32
R3024:Phf20 UTSW 2 156287867 missense probably damaging 0.96
R4242:Phf20 UTSW 2 156307454 unclassified probably benign
R5053:Phf20 UTSW 2 156273862 missense probably benign 0.00
R5089:Phf20 UTSW 2 156302862 missense probably benign
R5382:Phf20 UTSW 2 156267497 missense probably damaging 1.00
R5649:Phf20 UTSW 2 156251768 splice site probably null
R5707:Phf20 UTSW 2 156296771 intron probably null
R5751:Phf20 UTSW 2 156267341 missense probably benign 0.01
R5805:Phf20 UTSW 2 156307294 missense probably damaging 0.99
R5988:Phf20 UTSW 2 156307330 missense probably damaging 1.00
R6179:Phf20 UTSW 2 156298653 missense probably damaging 1.00
R6243:Phf20 UTSW 2 156223400 missense probably benign 0.16
R6338:Phf20 UTSW 2 156273686 missense possibly damaging 0.93
R6351:Phf20 UTSW 2 156294210 missense possibly damaging 0.91
R6584:Phf20 UTSW 2 156294123 missense probably damaging 0.99
R7248:Phf20 UTSW 2 156293411 splice site probably null
R7329:Phf20 UTSW 2 156304632 missense probably damaging 0.96
R7387:Phf20 UTSW 2 156294240 missense probably damaging 1.00
R7528:Phf20 UTSW 2 156303008 nonsense probably null
R7603:Phf20 UTSW 2 156302851 missense probably benign
RF011:Phf20 UTSW 2 156304620 critical splice acceptor site probably benign
RF011:Phf20 UTSW 2 156304621 critical splice acceptor site probably benign
RF028:Phf20 UTSW 2 156304623 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGGGACATTCGTTGAGC -3'
(R):5'- AGGATCAGTCTGTCTTCCTCTAAC -3'

Sequencing Primer
(F):5'- CAGCAGGCATCATTTGAGCTG -3'
(R):5'- AACCTGTGTTCTGGAAACTACTTGC -3'
Posted On2019-11-12