Incidental Mutation 'R7698:Atp8b5'
ID593765
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7698 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43366735 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 833 (T833I)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably benign
Transcript: ENSMUST00000107942
AA Change: T833I

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: T833I

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T G 1: 37,625,371 E482A probably benign Het
A630023A22Rik C A 14: 34,052,613 L140F unknown Het
Actn1 T C 12: 80,174,537 T581A probably benign Het
AI314180 C G 4: 58,832,660 C900S unknown Het
Ak9 T C 10: 41,348,076 L495S Het
Aldh5a1 T C 13: 24,911,748 D462G probably damaging Het
Amz2 A G 11: 109,429,007 D73G probably damaging Het
Ank2 A G 3: 127,032,211 Y361H probably benign Het
Atp8b1 A G 18: 64,571,022 Y342H probably benign Het
Camkk2 A G 5: 122,746,419 I313T probably damaging Het
Cdk18 T C 1: 132,122,378 T20A probably damaging Het
Cenpf A T 1: 189,662,072 C479S probably benign Het
Cfap221 C A 1: 119,961,929 E192* probably null Het
Cfap44 C T 16: 44,433,786 H958Y probably damaging Het
Cic A T 7: 25,273,172 Q776L possibly damaging Het
Cldn17 C A 16: 88,506,356 G162* probably null Het
Col19a1 T A 1: 24,312,078 Y748F probably benign Het
Col27a1 C T 4: 63,225,718 P548S possibly damaging Het
Ctsr T A 13: 61,162,567 M92L probably benign Het
Cyp2d12 T C 15: 82,558,970 V360A probably benign Het
Defa34 G T 8: 21,666,629 C91F probably damaging Het
Dennd2c G A 3: 103,165,043 V815I possibly damaging Het
Dlgap4 C T 2: 156,749,095 Q734* probably null Het
Dph1 A T 11: 75,190,441 S7T probably benign Het
Dpp8 T C 9: 65,042,336 V121A probably benign Het
Dst G A 1: 34,190,387 G2354S probably benign Het
Duox2 A T 2: 122,280,764 L1453Q probably damaging Het
Exosc10 T A 4: 148,558,498 S11T probably benign Het
Fetub A G 16: 22,939,309 T281A probably benign Het
Flii A T 11: 60,720,092 W504R probably damaging Het
Gm17727 T C 9: 35,777,176 M38V probably benign Het
Gm5093 T C 17: 46,439,940 R54G possibly damaging Het
Gmcl1 T C 6: 86,707,415 D375G probably benign Het
Hikeshi A T 7: 89,923,681 N101K probably benign Het
Hmcn2 T C 2: 31,423,153 V3458A probably damaging Het
Hspa2 A G 12: 76,405,309 N259S possibly damaging Het
Irf6 T C 1: 193,161,767 I110T probably damaging Het
Kcnj8 T A 6: 142,565,753 H376L probably damaging Het
Kdm6b G A 11: 69,405,981 P487S probably benign Het
Lcp1 C A 14: 75,206,211 Y222* probably null Het
Manea T C 4: 26,327,763 D426G probably damaging Het
Map3k20 G T 2: 72,364,681 E101* probably null Het
Map3k20 C G 2: 72,438,314 S555C probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myo6 C T 9: 80,217,656 P6S unknown Het
Myoc A T 1: 162,639,445 Q61L probably damaging Het
N4bp2 T A 5: 65,808,157 M1183K probably benign Het
Olfr1444 T C 19: 12,862,713 S313P possibly damaging Het
Olfr1468-ps1 T C 19: 13,375,040 F26S probably damaging Het
Olfr676 T A 7: 105,035,907 H236Q probably benign Het
Olfr889 T A 9: 38,115,892 L37* probably null Het
Osbpl11 C G 16: 33,234,447 N633K probably benign Het
Pcdhgb5 A G 18: 37,732,631 E493G probably damaging Het
Phf20 T A 2: 156,294,138 W626R probably damaging Het
Pkp2 C A 16: 16,240,659 Q402K probably benign Het
Plch2 C T 4: 155,002,787 D336N possibly damaging Het
Plk1 T C 7: 122,169,258 F535L probably damaging Het
Ppp1r9a A T 6: 4,906,430 E328D probably benign Het
Prss44 G A 9: 110,817,311 V369M probably benign Het
Rilp A G 11: 75,510,972 S193G probably benign Het
Rusc2 C T 4: 43,414,900 Q69* probably null Het
Ryr2 T C 13: 11,761,315 D1112G possibly damaging Het
Smc6 A G 12: 11,283,140 R238G possibly damaging Het
Spen A G 4: 141,472,845 S2824P probably damaging Het
Stk4 T C 2: 164,083,743 M77T probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Thsd1 C T 8: 22,258,987 R625* probably null Het
Tle3 A T 9: 61,412,856 N522I probably damaging Het
Tmcc1 C A 6: 116,043,802 E230* probably null Het
Vmn2r90 T C 17: 17,733,334 S587P probably benign Het
Wt1 A T 2: 105,126,816 Q7L probably benign Het
Zfhx2 T C 14: 55,062,849 I2482V probably benign Het
Zfpm2 A T 15: 41,096,091 I189F probably benign Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43355673 missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43357016 missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43371003 missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43370823 critical splice donor site probably null
R7883:Atp8b5 UTSW 4 43342471 missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43356982 nonsense probably null
R8218:Atp8b5 UTSW 4 43372728 critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43366072 missense probably damaging 0.97
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43361903 missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43370669 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACACATTAAGTAAGTGTGTCCTGG -3'
(R):5'- TCTCACTGTGTGCATGCCTG -3'

Sequencing Primer
(F):5'- GTCTGCAGGCCTATGCTCTAGAAG -3'
(R):5'- GCGGCAAACAATACATGCATATTTC -3'
Posted On2019-11-12